ID: 1067436985

View in Genome Browser
Species Human (GRCh38)
Location 10:46285077-46285099
Sequence CGAAGGCGGCGGGCGCTCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067436985_1067437000 13 Left 1067436985 10:46285077-46285099 CCCGCGAGCGCCCGCCGCCTTCG No data
Right 1067437000 10:46285113-46285135 AGCTGAGACCGCCAGGAAGGCGG No data
1067436985_1067436995 6 Left 1067436985 10:46285077-46285099 CCCGCGAGCGCCCGCCGCCTTCG No data
Right 1067436995 10:46285106-46285128 AGGCCCCAGCTGAGACCGCCAGG No data
1067436985_1067437001 14 Left 1067436985 10:46285077-46285099 CCCGCGAGCGCCCGCCGCCTTCG No data
Right 1067437001 10:46285114-46285136 GCTGAGACCGCCAGGAAGGCGGG No data
1067436985_1067436998 10 Left 1067436985 10:46285077-46285099 CCCGCGAGCGCCCGCCGCCTTCG No data
Right 1067436998 10:46285110-46285132 CCCAGCTGAGACCGCCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067436985 Original CRISPR CGAAGGCGGCGGGCGCTCGC GGG (reversed) Intergenic