ID: 1067439784

View in Genome Browser
Species Human (GRCh38)
Location 10:46302097-46302119
Sequence CTGGAATCACAGCTAAAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067439780_1067439784 25 Left 1067439780 10:46302049-46302071 CCTTGCTGGTTCAGGAAGAGCAG 0: 1
1: 1
2: 3
3: 16
4: 244
Right 1067439784 10:46302097-46302119 CTGGAATCACAGCTAAAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067439784 Original CRISPR CTGGAATCACAGCTAAAACA GGG Intronic
No off target data available for this crispr