ID: 1067440578

View in Genome Browser
Species Human (GRCh38)
Location 10:46307174-46307196
Sequence GCTGCTTGGTGTCACCATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 141}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067440578_1067440582 1 Left 1067440578 10:46307174-46307196 CCAGGATGGTGACACCAAGCAGC 0: 1
1: 0
2: 1
3: 15
4: 141
Right 1067440582 10:46307198-46307220 GTCCCTGGTCATTTAGGACGCGG 0: 1
1: 1
2: 0
3: 6
4: 85
1067440578_1067440585 10 Left 1067440578 10:46307174-46307196 CCAGGATGGTGACACCAAGCAGC 0: 1
1: 0
2: 1
3: 15
4: 141
Right 1067440585 10:46307207-46307229 CATTTAGGACGCGGTCACAATGG 0: 1
1: 1
2: 0
3: 0
4: 30
1067440578_1067440586 28 Left 1067440578 10:46307174-46307196 CCAGGATGGTGACACCAAGCAGC 0: 1
1: 0
2: 1
3: 15
4: 141
Right 1067440586 10:46307225-46307247 AATGGCATGAGACCCCATGCAGG 0: 2
1: 0
2: 0
3: 19
4: 494
1067440578_1067440587 29 Left 1067440578 10:46307174-46307196 CCAGGATGGTGACACCAAGCAGC 0: 1
1: 0
2: 1
3: 15
4: 141
Right 1067440587 10:46307226-46307248 ATGGCATGAGACCCCATGCAGGG 0: 2
1: 0
2: 0
3: 35
4: 729
1067440578_1067440581 -5 Left 1067440578 10:46307174-46307196 CCAGGATGGTGACACCAAGCAGC 0: 1
1: 0
2: 1
3: 15
4: 141
Right 1067440581 10:46307192-46307214 GCAGCAGTCCCTGGTCATTTAGG 0: 1
1: 0
2: 1
3: 37
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067440578 Original CRISPR GCTGCTTGGTGTCACCATCC TGG (reversed) Intronic
900244805 1:1631992-1632014 GCTGCCTGCTGTCTCCAGCCGGG - Intergenic
904475732 1:30763633-30763655 GCTGCTTGGAGTAACCTGCCTGG - Intergenic
905489538 1:38332706-38332728 GCTGCTGAGTGTCACCATACTGG - Intergenic
905692489 1:39953894-39953916 GGAGCATGGTGTGACCATCCTGG + Intergenic
906577189 1:46901593-46901615 GTGGCTTGGGGTCACCATCATGG + Intergenic
912549078 1:110472893-110472915 GCTTTGTGTTGTCACCATCCAGG + Intergenic
913702362 1:121385328-121385350 GCTGCCTGATGTCACCAGTCAGG - Intronic
914042925 1:144065824-144065846 GCTGCCTGATGTCACCAGTCAGG - Intergenic
914135161 1:144894664-144894686 GCTGCCTGATGTCACCAGTCAGG + Intronic
920489789 1:206404070-206404092 GCTGCCTGATGTCACCAGTCAGG - Intronic
923085974 1:230703874-230703896 GGTGCTTGCTGTCTTCATCCCGG + Intronic
1067440578 10:46307174-46307196 GCTGCTTGGTGTCACCATCCTGG - Intronic
1068270082 10:54711120-54711142 GCTGCTTGCTGTCACAACTCAGG + Intronic
1073467083 10:103700568-103700590 GCTGCTCAGTGTCACCATCTAGG - Intronic
1075420691 10:122298321-122298343 GCTGCTTGGTATCCCCCCCCAGG - Intronic
1076861664 10:133140812-133140834 GCTGCATCGTGTCAGCCTCCTGG + Intergenic
1077138901 11:1014883-1014905 GCTTCTTGGGGTCACCTCCCTGG + Intronic
1077544019 11:3161052-3161074 GCTGCCTGTTGTGACCAGCCTGG - Intronic
1077556738 11:3229690-3229712 GCTGCATGGTGTGACCAAGCTGG - Intronic
1078501193 11:11879317-11879339 GCTGTTTGGTTTCAGCAGCCAGG + Intronic
1080909583 11:36582094-36582116 GCTGCATTGTGTCCACATCCTGG - Intronic
1083100569 11:60301362-60301384 AATGCTTGGTGTCACTATCATGG - Intronic
1090401729 11:126453597-126453619 GCTGCTTGGTGAGACCTTGCTGG + Intronic
1090926302 11:131253550-131253572 GCTGCTCGGTGTGAGCATCCCGG + Intergenic
1091337737 11:134785226-134785248 GCTGGATGGTGTCACTATCGGGG + Intergenic
1091910135 12:4223858-4223880 GCAGCTGGATGTCACCATCTAGG - Intergenic
1092519661 12:9255765-9255787 GCTTCTTGGACACACCATCCAGG + Intergenic
1092932206 12:13326676-13326698 GCTGCATGATCTCAGCATCCAGG + Intergenic
1094527646 12:31242989-31243011 GGTGCTTGTTTTCCCCATCCAGG - Intergenic
1098329904 12:69342240-69342262 GCTCGTTGGTGTCACGATTCAGG - Intergenic
1100052237 12:90462363-90462385 GCTGCATTGTGTCCACATCCTGG - Intergenic
1101320935 12:103672569-103672591 GGTGCTTGGAGCCATCATCCAGG - Intronic
1103331912 12:120160061-120160083 GCTGCTTGCTGTCACAAGCAGGG - Intronic
1103725961 12:122997491-122997513 GCTGCACGGAGGCACCATCCTGG - Exonic
1106650237 13:31682671-31682693 GCTGTATGGTGGCACCATCTGGG - Intergenic
1108431950 13:50362105-50362127 GCTGATGGTTGTCAGCATCCAGG - Intronic
1113537600 13:111080696-111080718 GCTTCTTGGTATCACCATATTGG - Intergenic
1113661502 13:112109189-112109211 GCTGTTTGTTTTCAGCATCCAGG + Intergenic
1113832878 13:113310812-113310834 GCTCCATGATGCCACCATCCAGG + Exonic
1114771339 14:25430969-25430991 GCTGCTGGGTGTCGCGACCCAGG - Intergenic
1115933844 14:38529351-38529373 CCTGCTTGGTGTTAGCTTCCTGG - Intergenic
1117674096 14:58138542-58138564 GTTGCTTGGTGGCAGCAGCCTGG + Exonic
1118637811 14:67763981-67764003 GCTGCTGGGTGGAAGCATCCTGG + Intronic
1119696980 14:76720816-76720838 ACTGTTTGCTGTGACCATCCTGG + Intergenic
1121111099 14:91313712-91313734 GCTGCTTGTTGTCACGCTCCAGG + Exonic
1121527596 14:94630085-94630107 GCTCCTTGATGTCCCCAGCCTGG - Intergenic
1121598615 14:95185749-95185771 TCTGCTTGGAGACACCTTCCTGG - Exonic
1124181701 15:27481940-27481962 GCTGCTTGGTGACTCCCTTCAGG - Intronic
1128614470 15:69098631-69098653 GCTGGATGGTATCACCCTCCAGG + Intergenic
1129251898 15:74313822-74313844 CATGCTTGGTGCCAGCATCCAGG + Intronic
1132145132 15:99425088-99425110 CCTGCTTGGTGTCTGCAGCCCGG + Intergenic
1132670010 16:1098680-1098702 GCTGGCTGGTGGCACCAGCCTGG - Intergenic
1134248101 16:12555023-12555045 GCTGCTCGGTGGCACCAGGCAGG - Intronic
1139740468 16:69031123-69031145 GCTGCTTTGGGGCACCTTCCTGG + Intronic
1152730552 17:81967652-81967674 GCTGCATGTTGGCACCAGCCGGG - Intergenic
1152942508 17:83180363-83180385 GCTGCCTGGTGTGACCCTGCTGG + Intergenic
1155385821 18:25276075-25276097 TCTGCTTGGTGCCACCATACAGG + Intronic
1156160322 18:34351036-34351058 GCTCCTTGGTGCCAGCAGCCTGG + Intergenic
1157611303 18:48957863-48957885 GCTGATTGGAGTCAGGATCCAGG + Intergenic
1157856625 18:51110460-51110482 GCTGCGTGGTATCCCCAGCCCGG - Intergenic
1159766932 18:72502615-72502637 GCCGCTTGGTGCCAGCAGCCTGG - Intergenic
1163796996 19:19343500-19343522 GCTGCATGGTGTCATGATCCAGG + Intronic
1164534233 19:29073156-29073178 GCTGGTGGGTCTCACCATCATGG - Intergenic
1164583994 19:29454238-29454260 GCTGCTAGGTATGTCCATCCTGG - Intergenic
1164752555 19:30667436-30667458 GCTGCTTTCTGTGTCCATCCGGG + Intronic
1165342843 19:35224902-35224924 GCTGCTCGTGGTCACCGTCCTGG - Exonic
1165789816 19:38484537-38484559 GGGGCTTGGTGTCTCCAGCCTGG - Intronic
1167135021 19:47610533-47610555 GCTCTCTGGTGTCCCCATCCTGG + Intronic
925985817 2:9213827-9213849 GCTACTTAGTGTCAGAATCCAGG + Intronic
927927601 2:27024608-27024630 GTGGCTTGGTTTCTCCATCCAGG + Intronic
931063154 2:58554100-58554122 GCTGCTTGCTGTCACCACTGGGG + Intergenic
933015143 2:77114736-77114758 GCAGCTCGGGGTCACCATCATGG - Intronic
934562273 2:95319573-95319595 GATGCTTGGGGTCACTAGCCAGG - Intronic
935806607 2:106754652-106754674 ACTGCCTGGAGTCACAATCCAGG - Intergenic
937342334 2:121099214-121099236 GCTGCTAGGTGACACCAACAGGG - Intergenic
937382110 2:121387801-121387823 GGAGTTTGGTGGCACCATCCTGG + Exonic
939118418 2:138088141-138088163 GGAGCTTGGTGTCAGCCTCCAGG - Intergenic
941647141 2:168052738-168052760 GCTGCTTGCTGTGAGCACCCAGG - Intronic
942420667 2:175804135-175804157 GCTGCTCTGTGTCACTATCTAGG - Intergenic
943496657 2:188629305-188629327 GCTTTTTGGTGTCTCCATCATGG - Intergenic
943767806 2:191680335-191680357 GCTCCTTGGTGTTACCTTGCAGG + Intronic
944418155 2:199499290-199499312 CCAGCTTGGTTTCACCATCTTGG + Intergenic
945264956 2:207881844-207881866 GCTGCTTGGAGGCACCATCCTGG + Intronic
946109911 2:217405726-217405748 GCTGCATTGTGGCACCACCCAGG - Intronic
946125833 2:217561901-217561923 GCAGCTTGGGGTCACCATCATGG + Intronic
946408784 2:219506400-219506422 GCTGCCTGCTATCACCATCCTGG + Exonic
948489049 2:238299854-238299876 GCTCCTTGATGCCAACATCCAGG + Intergenic
1169430404 20:5531289-5531311 GCTGCTTGCTTTCCCCAGCCAGG + Intergenic
1170462964 20:16596511-16596533 GCTGCTGGGTATCCCCAACCAGG - Intergenic
1170897855 20:20432312-20432334 GCTGCCTTGTGTCACAAACCAGG + Intronic
1172634627 20:36401602-36401624 GCTGCTGGGTGCCAGCATCGTGG + Intronic
1173662308 20:44743162-44743184 GCTGTTTTGTGTCACTATCCAGG - Intergenic
1173808005 20:45938836-45938858 GCTGCTGTGTGGCACCATGCTGG + Intronic
1175147238 20:56906126-56906148 GCTGCTTAGTGTCTCTCTCCTGG + Intergenic
1175894875 20:62331560-62331582 GCTGCTTGGTGCCACCAGGCCGG + Intronic
1176297332 21:5081093-5081115 GCTGCCTGGTGCCACCACCCAGG + Intergenic
1177320022 21:19509044-19509066 GCTGCTATGTTACACCATCCTGG - Intergenic
1179859697 21:44180855-44180877 GCTGCCTGGTGCCACCACCCAGG - Intergenic
1182859039 22:33543230-33543252 ACTACTTGGGCTCACCATCCTGG - Intronic
1184952040 22:47850277-47850299 GGAGCTTGGTCTCACCACCCAGG + Intergenic
950264213 3:11562586-11562608 GCTGCTTGGTGTCCTCAGCAGGG + Intronic
952957836 3:38568697-38568719 GCAGGTTGGTGTCACAAACCAGG - Intronic
954219013 3:49141282-49141304 GTGGCTTGGGGTCACCATCACGG + Intergenic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
954332396 3:49898000-49898022 GCTGCTTGGTTTCCCCCTTCAGG + Intronic
959293401 3:104503218-104503240 GCTGCTTGGTGTTGCCCTGCCGG - Intergenic
960246463 3:115405420-115405442 ACTGCTTCCTGTCTCCATCCTGG + Intergenic
968193267 3:196686402-196686424 GCTGCTTGGTGTCAGCACTGGGG + Intronic
968289353 3:197526648-197526670 GCTGCTTGGAGTCACCTTAAGGG - Intronic
968702828 4:2064830-2064852 GCTGACTGGTGTCATCACCCAGG + Exonic
969283985 4:6190998-6191020 GCTGCTGTTTGTCCCCATCCTGG - Intronic
973244029 4:47990667-47990689 GCGGCTCGGCGTCACCATCATGG + Intronic
982001086 4:151021910-151021932 TCTGCTTGAAGTCAACATCCTGG - Intergenic
982156544 4:152527748-152527770 GTTGCTTGTTGTCACCAGGCTGG - Intronic
982821780 4:159949644-159949666 GCTGCTTGGTAGCACCATGTTGG - Intergenic
983260771 4:165453751-165453773 GCTGCTTTGGGTCTCCCTCCAGG - Intronic
993172467 5:84436271-84436293 GCAGCTTGGAGTCAGCATCACGG + Intergenic
1000876020 5:166639148-166639170 CCTCCTTGGTGTCACCTCCCAGG + Intergenic
1001131637 5:169069263-169069285 GCTGCTGGGTACCACCTTCCAGG + Intronic
1001704293 5:173730670-173730692 GCTGCTTGGTGGGGCCTTCCTGG + Intergenic
1002133556 5:177095415-177095437 CCTGCTTGGTGTCTGCACCCAGG + Exonic
1002804971 6:564612-564634 ACTGCTTGGCTTCCCCATCCCGG + Exonic
1003477069 6:6492927-6492949 GCTGCTGGGCGTTCCCATCCTGG + Intergenic
1006422109 6:33941533-33941555 CCTTCTTGGTGTCTGCATCCTGG - Intergenic
1008624044 6:53300568-53300590 GTGGCTTGCTGTCACCATTCAGG - Intronic
1012328584 6:97956201-97956223 CCTGCTTGGTGTTAGCTTCCTGG + Intergenic
1016613048 6:146015017-146015039 GCTGGTTGGTCTCTCCCTCCTGG - Intergenic
1017086823 6:150720797-150720819 GCTGCTGGGTTTCACCTTCCTGG - Intronic
1017907459 6:158766940-158766962 GCTGCTTGGTGTTGCCCTGCCGG + Exonic
1019333629 7:472325-472347 GCTGCCAGGTGCCACCACCCGGG - Intergenic
1031763000 7:125737661-125737683 GCGGCTTGAAGTCACCATCACGG - Intergenic
1032504450 7:132424940-132424962 TCTGCTGGGTGTCAGCATCACGG + Intronic
1034211828 7:149370447-149370469 ACTGATTGGTGACACCATCCCGG + Intergenic
1035451747 7:158981188-158981210 CCTGCTTGGTCTGACCAGCCAGG - Intergenic
1037224014 8:16561807-16561829 GCTGCTTGGTTTCACTACCATGG - Intronic
1037520774 8:19678824-19678846 CCTGCTTGGTGTCACTTACCAGG - Intronic
1037898887 8:22676058-22676080 GTTGCTTGGTCTGACCTTCCTGG - Intergenic
1037916212 8:22774978-22775000 GCTCCTGGGTGACACCATCCTGG + Intronic
1041346093 8:56899608-56899630 GCTGCTTGGCTTCACTCTCCAGG + Intergenic
1041980282 8:63850044-63850066 TCTGCTTGGTGTCAGCATGTAGG - Intergenic
1045711412 8:104988957-104988979 GCTGATTGGTGTTACCAGTCAGG - Intronic
1048670375 8:136712550-136712572 GCAGCTTGGAGTCGCCATCATGG + Intergenic
1049465408 8:142749182-142749204 GCCCCTGGGTGTCACCCTCCTGG - Intergenic
1049544708 8:143224923-143224945 ACTGCTTCTTGTCACCCTCCTGG + Intergenic
1049573940 8:143382000-143382022 CCAGCTTGCTGTCACCACCCTGG + Intronic
1050462357 9:5887378-5887400 GCTGCCTGTTGTCTCCACCCTGG + Intronic
1052777231 9:32744074-32744096 CCTGCTTGGCTTCACCATTCTGG - Intergenic
1053218772 9:36294187-36294209 GCTGCTTGGGGAAACCATGCGGG + Intronic
1056221245 9:84452506-84452528 GCTGCTTCAAGTCACCATTCAGG - Intergenic
1056818102 9:89816312-89816334 GCAGCTTGCTCGCACCATCCTGG - Intergenic
1059514507 9:114880494-114880516 GCTGCTTGGGGTCAGCCTCAAGG + Intergenic
1059672972 9:116508907-116508929 GCTCACAGGTGTCACCATCCAGG + Intronic
1188058167 X:25565274-25565296 GCTGCTTGGTGCTGACATCCTGG + Intergenic
1189744892 X:44158926-44158948 GCTGCTGGGAGTCCCCTTCCTGG + Intronic
1191870284 X:65739845-65739867 GCTGCTTGGTGTTGCCCTGCCGG - Exonic
1192842460 X:74871251-74871273 GCAGCTTGAGGTCACCATCATGG - Intronic
1196193369 X:112816325-112816347 GCTGTTTGTTGTTTCCATCCTGG - Intronic
1200102246 X:153693996-153694018 GCTGCTTGGTCTCGACAGCCAGG + Exonic