ID: 1067441375

View in Genome Browser
Species Human (GRCh38)
Location 10:46310873-46310895
Sequence GAGGCAGGTGTGGCTCCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067441368_1067441375 -5 Left 1067441368 10:46310855-46310877 CCCTGTCCCCAGGCTCTAGAGGC 0: 1
1: 0
2: 0
3: 48
4: 288
Right 1067441375 10:46310873-46310895 GAGGCAGGTGTGGCTCCATTTGG No data
1067441364_1067441375 14 Left 1067441364 10:46310836-46310858 CCGTGTTTCAGGGACCTGGCCCT 0: 1
1: 0
2: 3
3: 24
4: 211
Right 1067441375 10:46310873-46310895 GAGGCAGGTGTGGCTCCATTTGG No data
1067441366_1067441375 0 Left 1067441366 10:46310850-46310872 CCTGGCCCTGTCCCCAGGCTCTA 0: 1
1: 0
2: 4
3: 55
4: 569
Right 1067441375 10:46310873-46310895 GAGGCAGGTGTGGCTCCATTTGG No data
1067441363_1067441375 15 Left 1067441363 10:46310835-46310857 CCCGTGTTTCAGGGACCTGGCCC 0: 1
1: 1
2: 0
3: 11
4: 194
Right 1067441375 10:46310873-46310895 GAGGCAGGTGTGGCTCCATTTGG No data
1067441362_1067441375 16 Left 1067441362 10:46310834-46310856 CCCCGTGTTTCAGGGACCTGGCC 0: 1
1: 1
2: 1
3: 9
4: 131
Right 1067441375 10:46310873-46310895 GAGGCAGGTGTGGCTCCATTTGG No data
1067441369_1067441375 -6 Left 1067441369 10:46310856-46310878 CCTGTCCCCAGGCTCTAGAGGCA 0: 1
1: 0
2: 3
3: 45
4: 257
Right 1067441375 10:46310873-46310895 GAGGCAGGTGTGGCTCCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067441375 Original CRISPR GAGGCAGGTGTGGCTCCATT TGG Intronic
No off target data available for this crispr