ID: 1067442287

View in Genome Browser
Species Human (GRCh38)
Location 10:46315456-46315478
Sequence CTCTTCACTGCAGAGTGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067442285_1067442287 5 Left 1067442285 10:46315428-46315450 CCTGCCAGGACAGGCATAGGCTG 0: 2
1: 0
2: 2
3: 18
4: 217
Right 1067442287 10:46315456-46315478 CTCTTCACTGCAGAGTGAAGAGG No data
1067442286_1067442287 1 Left 1067442286 10:46315432-46315454 CCAGGACAGGCATAGGCTGTCTG 0: 2
1: 0
2: 1
3: 6
4: 123
Right 1067442287 10:46315456-46315478 CTCTTCACTGCAGAGTGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067442287 Original CRISPR CTCTTCACTGCAGAGTGAAG AGG Intronic
No off target data available for this crispr