ID: 1067442921

View in Genome Browser
Species Human (GRCh38)
Location 10:46321318-46321340
Sequence TTAAGATTTCTCTGACATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 229}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067442921_1067442925 28 Left 1067442921 10:46321318-46321340 CCATGATGTCAGAGAAATCTTAA 0: 1
1: 0
2: 2
3: 24
4: 229
Right 1067442925 10:46321369-46321391 CTAGGATGTTGTCTGCTTCTGGG No data
1067442921_1067442926 29 Left 1067442921 10:46321318-46321340 CCATGATGTCAGAGAAATCTTAA 0: 1
1: 0
2: 2
3: 24
4: 229
Right 1067442926 10:46321370-46321392 TAGGATGTTGTCTGCTTCTGGGG No data
1067442921_1067442924 27 Left 1067442921 10:46321318-46321340 CCATGATGTCAGAGAAATCTTAA 0: 1
1: 0
2: 2
3: 24
4: 229
Right 1067442924 10:46321368-46321390 TCTAGGATGTTGTCTGCTTCTGG No data
1067442921_1067442922 10 Left 1067442921 10:46321318-46321340 CCATGATGTCAGAGAAATCTTAA 0: 1
1: 0
2: 2
3: 24
4: 229
Right 1067442922 10:46321351-46321373 TTGAAAAGTTGTCCATTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067442921 Original CRISPR TTAAGATTTCTCTGACATCA TGG (reversed) Intronic
901888172 1:12238953-12238975 TTAACAGTCCTCTGAGATCAGGG - Intronic
909277702 1:73709357-73709379 TGAAGATTTCCCTGGAATCAAGG - Intergenic
910303074 1:85729360-85729382 CTAATATTTCTCTGATAACAAGG + Exonic
913072470 1:115312747-115312769 TAAACATTTCTGTGACTTCAAGG - Intronic
914451940 1:147800268-147800290 TTATGAGTTTTCTGACATCCAGG - Intergenic
915678957 1:157561338-157561360 TTAAAATTTCTCTGATGTCATGG + Intergenic
917922638 1:179763778-179763800 TTAGGATTTCTCTGCCATTTTGG - Intronic
918182052 1:182092567-182092589 TTAACATTTTTCTGATATCTTGG - Intergenic
918258986 1:182776880-182776902 TTAAAATATTTCTGACAACATGG - Intergenic
918834271 1:189440206-189440228 GAAAGATTTCTCTGAAAGCAAGG - Intergenic
919447474 1:197726816-197726838 CTTAGATTTCTCTAACATGAAGG - Intronic
920969213 1:210728506-210728528 TTAAGATTTCCATGTCATCAAGG - Intronic
921107296 1:211995446-211995468 TTAACCTTTCTCTGTCATCTAGG - Intronic
923450593 1:234113562-234113584 TTAAGATTTCGGTGACATGTAGG + Intronic
924441053 1:244085755-244085777 TTATTATTTCTAGGACATCAAGG + Intergenic
1063054785 10:2492939-2492961 TCAGGTTTTCTCTGAGATCAGGG + Intergenic
1063891729 10:10637046-10637068 ATGAGATTTCTCTGAATTCAAGG - Intergenic
1063983677 10:11478486-11478508 TTGAGATTGCACTGACATTAAGG - Intronic
1064947436 10:20806521-20806543 GGAAGGTTTCCCTGACATCAAGG + Intronic
1065122189 10:22541159-22541181 TTAAGATTTATCTGACTCTAGGG + Intronic
1065411586 10:25435367-25435389 TGAAGATTTCTCTGAGGTCCTGG + Intronic
1066394216 10:35003434-35003456 TTAAGATGGCTCTGTCATCCTGG + Intergenic
1067442921 10:46321318-46321340 TTAAGATTTCTCTGACATCATGG - Intronic
1068348282 10:55812761-55812783 TCAAGACTTCTCTGCTATCATGG - Intergenic
1072053102 10:91725997-91726019 TTGAGATGTCTCTGTCATCCAGG + Intergenic
1072432527 10:95385954-95385976 TTTAGTTTTCTTTGACATCATGG - Intronic
1073515066 10:104068918-104068940 TTATCATTTCTCTCCCATCAGGG - Intronic
1076121795 10:127942143-127942165 TTCTCATTTCTCTGACATCGTGG - Intronic
1078077461 11:8174831-8174853 TCAAAATTTCTTTAACATCAGGG + Intergenic
1080765177 11:35289324-35289346 TGAAGGTTTCTTTGCCATCATGG - Intronic
1081337505 11:41884867-41884889 TTTAGATTTGTCCCACATCAAGG + Intergenic
1082843689 11:57710528-57710550 CTAAGCTTTTTCTCACATCAGGG + Intronic
1082870354 11:57938734-57938756 TGAAGATTCCTCTGACATCCTGG - Intergenic
1086332774 11:85770492-85770514 TTTGGACTTCTCTGCCATCAGGG - Intronic
1089875313 11:121715694-121715716 CCAAGAATTCTCTGGCATCATGG + Intergenic
1093295474 12:17384319-17384341 CCAACATTCCTCTGACATCAGGG + Intergenic
1093658959 12:21731712-21731734 GTAGGATTTTTCTGGCATCAAGG - Intronic
1093988191 12:25561353-25561375 TAAAGATTTCTTTGAAACCAAGG - Intronic
1095464420 12:42475724-42475746 TTAAGTATTCTCTGATATAAAGG - Intronic
1095814253 12:46404206-46404228 TTAATATCTCTCTGACATTTGGG + Intergenic
1098352634 12:69580453-69580475 GAAAGATTTCTCTGACAACATGG + Intergenic
1098549510 12:71747614-71747636 GCAAGATGTCTCTGCCATCATGG - Intergenic
1098618856 12:72565646-72565668 TTCAGATGTCACTGTCATCAGGG - Intronic
1099338088 12:81391056-81391078 ATAATACTTTTCTGACATCAAGG + Intronic
1099918946 12:88933071-88933093 TTAAAATTTCCCTGAATTCATGG - Intergenic
1100284653 12:93153656-93153678 TTCAGAGTTATCTGCCATCAAGG - Intergenic
1105543899 13:21338071-21338093 TTCAGGTTTCTTTGAAATCAAGG + Intergenic
1105992213 13:25633343-25633365 GTATGATTTCTCAGACTTCAAGG + Intronic
1106376059 13:29189361-29189383 TTAATATTTATCTTACATCATGG + Intronic
1106661265 13:31802014-31802036 TTAAGTTTTCTCTCACCTGAAGG - Intronic
1106798312 13:33230461-33230483 TGAAGATTTTTCTGAAATAAAGG - Intronic
1108754695 13:53485842-53485864 TAAAAAAATCTCTGACATCATGG + Intergenic
1109899809 13:68752793-68752815 TTGTGGTTTCTTTGACATCAAGG + Intergenic
1110784123 13:79503218-79503240 ATAAGAGTTCACTGACACCATGG - Intronic
1110854813 13:80284425-80284447 TTAGGGTATCTCTGAAATCAGGG - Intergenic
1111149729 13:84234609-84234631 TTTATATCTTTCTGACATCAGGG - Intergenic
1111250735 13:85597794-85597816 TTAAGAATTTTGTGGCATCATGG - Intergenic
1111677178 13:91400850-91400872 TTTAGTTTTCCCTGACATCCTGG - Intronic
1111826348 13:93273150-93273172 TTTAGTTCTCTCTGACATCTAGG + Intronic
1112219144 13:97470485-97470507 CTAGGATGTCTTTGACATCAGGG - Intergenic
1113017540 13:105844618-105844640 TTAAGGTGTCTCTGAAAGCATGG - Intergenic
1116636246 14:47400063-47400085 TTATGATTGCTCTGTCAACAAGG - Intronic
1118196716 14:63633756-63633778 TTGTTATTTCTCTGATATCAGGG - Intronic
1118564153 14:67120572-67120594 GTAAGATTCCTCTGTTATCAGGG - Intronic
1120090371 14:80324956-80324978 TTCTGATTTCTCTGAAATCTTGG + Intronic
1120415948 14:84218234-84218256 TTTATATTTCTCTTACAACATGG + Intergenic
1120777487 14:88453546-88453568 TTTTGATTTCTCAGACCTCACGG + Intronic
1123683018 15:22776005-22776027 TCAGGTTTTTTCTGACATCATGG + Intronic
1126719721 15:51565521-51565543 TGAAGCCTTCTCTGACATCCTGG + Intronic
1126952780 15:53900446-53900468 TAAACATTTCTCTGTCACCATGG - Intergenic
1127212997 15:56794295-56794317 TTAATAGGTCTCTGACATCCAGG - Intronic
1127452867 15:59133768-59133790 TTAAGATTTCACTGGCAGTAGGG - Exonic
1127579981 15:60329381-60329403 TTAAGAGTTTTCTATCATCAAGG + Intergenic
1128568544 15:68717006-68717028 TTAAGATTGCTCTGGCAGCCAGG + Intronic
1130225154 15:82051571-82051593 TTAAAATCTCTCAGAAATCAAGG + Intergenic
1131664154 15:94552272-94552294 TTAAGAGTTCCCTGTCACCATGG + Intergenic
1133105325 16:3504171-3504193 TTAAGATTTCTCTAAATACAAGG + Intronic
1133900569 16:9970057-9970079 TCGAGATTTCTTTGACGTCAAGG - Intronic
1139222894 16:65202549-65202571 TGGAGATCTCTCTTACATCATGG + Intergenic
1140308156 16:73823183-73823205 TTAAGCTTTCCCTGACCTCATGG - Intergenic
1140922662 16:79553278-79553300 TGCAGATTTCTCTGCCATGATGG - Intergenic
1140991259 16:80213899-80213921 TTACAATTCCTCAGACATCAAGG + Intergenic
1145737637 17:27244272-27244294 TGAAGTATTCTCTGACTTCAAGG + Intergenic
1145881373 17:28355172-28355194 TGAAGATTTCTCTAACATAGTGG - Intronic
1149571962 17:57678421-57678443 GTAAGGTTTCTCTGAGAACAGGG + Intronic
1149588020 17:57806556-57806578 TTTTGATCTCTCTGAGATCAGGG - Intergenic
1153880630 18:9418796-9418818 TGAAGATTACTCTGGAATCAAGG - Intergenic
1154029329 18:10737964-10737986 TTCAGATTTTTCTGAAATCGTGG - Intronic
1155758964 18:29540442-29540464 CAAGGTTTTCTCTGACATCAGGG - Intergenic
1155894932 18:31313243-31313265 TTAAGATTTCCCTTAGATCTGGG + Intergenic
1156740490 18:40321415-40321437 TTAAGATCTCTGTCACATCATGG - Intergenic
1157819447 18:50754727-50754749 TCAAGTTTTCCCAGACATCATGG + Intergenic
1159119634 18:64153674-64153696 TTATGCTTTTTCTGACCTCAGGG + Intergenic
1159671268 18:71224043-71224065 GTAAGATTTTTCTAAAATCAGGG + Intergenic
1165087701 19:33362740-33362762 TGCAGATTTCTCAGACATGAAGG + Intergenic
1166438286 19:42788222-42788244 TTTAGATTTCTCTGGAAGCAAGG - Intronic
1166473316 19:43098956-43098978 TTTAGATTTCTCTGGAAGCAAGG - Intronic
925745530 2:7040114-7040136 AAAAGACTTCTCTGACAACATGG - Exonic
925857436 2:8143545-8143567 TTAGGAGTTCTCTTAAATCAGGG + Intergenic
926033305 2:9612272-9612294 TTAAGATTAATCTGGCAGCAAGG - Intronic
928576039 2:32656328-32656350 TGAAGGTTTCTCTGACCTCCCGG - Intronic
931153525 2:59601552-59601574 GTAAGATTTTACTGACATGATGG - Intergenic
931384193 2:61782555-61782577 TGAAGATTTTTCTGTCATTAAGG - Intergenic
931529058 2:63191643-63191665 CTATTATTTCTATGACATCAAGG + Intronic
931791620 2:65668676-65668698 TTAAGAGTTCTCTGCCATCATGG + Intergenic
931812884 2:65872275-65872297 TAAAGATTTCTATGACTGCATGG + Intergenic
932093087 2:68824151-68824173 TAAAGACTTCTGTGACATCTTGG + Intronic
933237882 2:79885456-79885478 TTATGATTTCTTCAACATCAGGG + Intronic
939604509 2:144237244-144237266 TGAAGATTTCTGTGACATGCTGG - Intronic
940099592 2:150019021-150019043 TTGAGTTTTCTCTGACATCAAGG + Intergenic
940621430 2:156118431-156118453 TAAACATTTCTCTGACTTCTTGG + Intergenic
941335511 2:164239622-164239644 TTAAGATCACTCTGGCATCTGGG + Intergenic
941848877 2:170159294-170159316 CTGAGATTTGTCTGACTTCAAGG + Intergenic
942826203 2:180179986-180180008 TCAAGTTTTCTCTAACAGCAAGG - Intergenic
943079009 2:183234536-183234558 TTAATATTTCTTTGAGATGAAGG + Intergenic
943554817 2:189389541-189389563 TAAAGATTGCACTGACAGCATGG - Intergenic
945004537 2:205390184-205390206 TTAAGATTTTTATGACACAATGG + Intronic
945467820 2:210190586-210190608 TTAAGATTTCTCTGCCATGCTGG - Intronic
947459510 2:230291191-230291213 TTAAGATTGGTCTGAGATGATGG - Intronic
949067303 2:242000149-242000171 TTAAAATTTCTATTACATTATGG + Intergenic
1169643720 20:7784991-7785013 TTAAGATTGCTCTGCCATCTTGG + Intergenic
1170114816 20:12846084-12846106 TGAAAATTTCTCTGCCACCAAGG + Intergenic
1170529066 20:17271344-17271366 TTAAGATTTCCCTGGTATCATGG + Intronic
1170537377 20:17354480-17354502 GAAATATTTCTCTGACATTAAGG + Intronic
1172899193 20:38321393-38321415 TTAAGCTTCCTCTCACCTCAGGG + Intronic
1175025472 20:55897720-55897742 TTGAGAGGTCTATGACATCATGG - Intergenic
1177711997 21:24789107-24789129 TTTAGGTTTCTCTGACATTGTGG + Intergenic
1178783926 21:35634670-35634692 TTCACATTTCTCTGACTTCCAGG - Intronic
1180034386 21:45236240-45236262 TTATGATGTCACTGACCTCATGG - Intergenic
1180046155 21:45306691-45306713 TTCAGCTTTCTCTGAAATGAGGG + Intergenic
1180149062 21:45938467-45938489 TTCAGATCTCTCTGCCACCAGGG + Intronic
1184579767 22:45408089-45408111 TTATGATTTCTCTGTCTTCAAGG + Intronic
950822827 3:15779546-15779568 TTAAGATATCTTTGAGATCTTGG + Intronic
951537121 3:23750417-23750439 TTTTAATCTCTCTGACATCAGGG - Intergenic
951794803 3:26526478-26526500 ATAAGATTAATCTGAAATCATGG - Intergenic
952601395 3:35088292-35088314 TTCAGCTTTTTCTGAGATCATGG + Intergenic
953016630 3:39083093-39083115 TTAAGATGTGACTAACATCATGG + Intronic
953832135 3:46308613-46308635 TTAAGATTTCTATGTCTTCTTGG + Intergenic
955593053 3:60558387-60558409 TAAATATTTCTCTGATGTCATGG + Intronic
957307048 3:78470598-78470620 GTAGGATTTCTCTGAAATGAGGG - Intergenic
958550420 3:95605534-95605556 TTAATATTTCTCTCAGCTCAAGG - Intergenic
958935831 3:100254447-100254469 TTAAGTTATCTCTGATATCGGGG - Intergenic
960341435 3:116479506-116479528 TTAAGATTTCACTGCCCTCCTGG + Intronic
962196776 3:133370596-133370618 GGAACATCTCTCTGACATCATGG - Intronic
963186689 3:142426287-142426309 TTAAGATTTTTATGACTTTAAGG - Intronic
965831963 3:172801389-172801411 TCAAGATTAATGTGACATCAGGG - Intronic
965915611 3:173842601-173842623 TTAAGATTTGTCTGCCATGTTGG - Intronic
969857623 4:10013177-10013199 TTAATAGTTCTCTGCCATCTGGG + Intronic
970435347 4:16028384-16028406 GTAATATTTATCTGCCATCATGG - Intronic
970479854 4:16461961-16461983 ATAAGATTTGTCTGTGATCATGG - Intergenic
972126365 4:35771588-35771610 TCAAGGTTTCTCTGAAATCTTGG - Intergenic
972932184 4:44085653-44085675 TTAATATGTCTCTGAGATCTGGG - Intergenic
973076570 4:45935415-45935437 TTATGATTCCTCTTACATAAAGG + Intergenic
976595406 4:86891048-86891070 TTAAGATACATCTGACACCAGGG + Intronic
979383433 4:120035809-120035831 TTAAGAAATATCTGACATCAGGG - Intergenic
979773332 4:124557051-124557073 TTAAGTTTTCACTGACTTCCAGG + Intergenic
980638962 4:135547813-135547835 TTAATATTTCTCTAGTATCAGGG - Intergenic
981500832 4:145449681-145449703 TGAAGATTCCTGAGACATCACGG - Intergenic
982963113 4:161865547-161865569 TCATGATTTTTCTGACATCCCGG - Intronic
983752408 4:171291987-171292009 ATTATATTTCTATGACATCATGG + Intergenic
986248972 5:6038351-6038373 TGACAATTTCACTGACATCAGGG - Intergenic
986566588 5:9122047-9122069 TTAAAATTTCTCTGTGATCATGG + Intronic
986636875 5:9831684-9831706 TTTAGATTTCTGTTTCATCAAGG + Intergenic
986705359 5:10450136-10450158 TTAATAATTCTGTGTCATCATGG + Intronic
986884715 5:12218964-12218986 TTCAGATTTCTCTGTCAATAAGG + Intergenic
989439965 5:41458691-41458713 TTTAGTTTTCTGTGACCTCAAGG - Intronic
989507616 5:42245566-42245588 TAAAGGTTTCTCTGTCAACATGG + Intergenic
989609977 5:43281625-43281647 CCAAGACTTCTCTGACATGAAGG - Intergenic
990356718 5:54974918-54974940 TTAAAGTTTCTCTGACTTCTCGG + Intergenic
990377833 5:55190464-55190486 TTAAGATTTCTCTTTTAACATGG + Intergenic
991204496 5:64034978-64035000 TTGAGATCTCTCTGGCATCTGGG + Intergenic
991416106 5:66394645-66394667 TTGAGGTTTCTCTGACAGCTTGG - Intergenic
993693258 5:91028618-91028640 TTAAGACATCTCTACCATCAAGG + Intronic
993794710 5:92252411-92252433 TTTGTATTTCTCTGAGATCAGGG - Intergenic
994514309 5:100751534-100751556 GTGAGATTTTTCAGACATCATGG + Intergenic
994604525 5:101950777-101950799 TTAAAACTTCTATGACATGAAGG - Intergenic
995339651 5:111043720-111043742 GTAAGATTGCTCTAAAATCAAGG + Intergenic
995972746 5:117992548-117992570 GTAAGATTTCTCTGACCCCAGGG - Intergenic
996967827 5:129325809-129325831 TTAAGATTTATCTGACAGATAGG - Intergenic
1000109238 5:158092015-158092037 AGAAGATTCCACTGACATCAGGG + Intergenic
1000348333 5:160332885-160332907 GTAAGATATTTCTGCCATCATGG - Intronic
1002987724 6:2206993-2207015 TTATGTTTTCTCTGACCTCATGG - Intronic
1003408193 6:5840317-5840339 TTCAGGTTTCTTTGAAATCAAGG - Intergenic
1003439669 6:6127559-6127581 TCAAAATTTATCTGACATTAAGG + Intergenic
1003527423 6:6909822-6909844 GGAAGACTTCTCTGACTTCACGG - Intergenic
1005336811 6:24805097-24805119 TTAGGATTTCTCTGACTTCTAGG + Exonic
1005869894 6:29967073-29967095 TTATTATTTCTCTCCCATCAGGG - Intergenic
1006107642 6:31726170-31726192 GTAGGATCTCTCTGACTTCAGGG - Intronic
1007042619 6:38738162-38738184 TTAAGATATTTCTCACTTCAAGG + Intronic
1007096826 6:39218442-39218464 TTCAGATTACTCTAACAACACGG - Intronic
1007544632 6:42684097-42684119 TTAAGAGTTTTCTGACGTCAGGG - Intronic
1007624742 6:43238379-43238401 TTAATATTTCTCTGCCACTAAGG - Intergenic
1008416509 6:51247120-51247142 CAAAGATCTCTCTGACATCAAGG + Intergenic
1008639290 6:53444937-53444959 TAATGATTTCTCTGGCAGCAGGG + Intergenic
1009349748 6:62660051-62660073 TTAAGATATCACTGTCATCCAGG + Intergenic
1009987408 6:70797605-70797627 TTATTATTTCTCTCACATTATGG + Intronic
1010134207 6:72531654-72531676 GTAATGCTTCTCTGACATCAAGG + Intergenic
1010566750 6:77424764-77424786 TTAACATTTCTTTATCATCAAGG - Intergenic
1011268142 6:85547226-85547248 TTAATCTTTCTCTTATATCAAGG - Exonic
1011823405 6:91278750-91278772 TTAAGCCTTCTCTGAGCTCAGGG + Intergenic
1012574721 6:100779898-100779920 TTAAGATTTCTCTATGATTAGGG - Intronic
1014964725 6:127733457-127733479 CTAACAATTCGCTGACATCAAGG + Intronic
1015407511 6:132854492-132854514 ATATAATTTCTCTGACATCAGGG - Intergenic
1015668635 6:135661628-135661650 TTAAGTTTTCTCTGTCTTCTTGG - Intergenic
1015896217 6:138019602-138019624 TTAAGATTTTTCTGGCAAAATGG + Intergenic
1018078434 6:160237632-160237654 TTAAGAGTTCTCTTACAAAAGGG + Intronic
1018153295 6:160961036-160961058 CTAAGAATTCTCTCACATCTAGG + Intergenic
1018266127 6:162026198-162026220 ATAAGAGTTCTCTGTCTTCACGG - Intronic
1020331735 7:7024616-7024638 TGAAAATATCTTTGACATCATGG - Intergenic
1020887597 7:13837745-13837767 CTACGATTTCTCTGAAAACAAGG + Intergenic
1020907994 7:14089460-14089482 TTAAGTTTTATCTGTCACCATGG - Intergenic
1021844256 7:24748731-24748753 TTGAGCTTTCACTGACACCATGG - Intronic
1023167131 7:37354021-37354043 TAAAGATCTCCCTGACCTCACGG + Intronic
1024663590 7:51522718-51522740 TGAAGATTTCTCAGTCATTAGGG - Intergenic
1029224266 7:99013775-99013797 AGAAGATGTTTCTGACATCATGG - Intergenic
1030576264 7:111289839-111289861 TTAAGCCTTCTGTGACCTCACGG + Intronic
1033519244 7:142143952-142143974 TTGACATTTATTTGACATCAAGG - Exonic
1034412897 7:150950498-150950520 TTGAGATTTCTCTGACATGGAGG - Intronic
1036186162 8:6624199-6624221 TTCAGAGTTCTCTGACTTCCAGG + Intronic
1037123020 8:15312905-15312927 TTGAGGTTTCTCAGACATCACGG - Intergenic
1037740985 8:21609054-21609076 TTAGGATTTCTGCTACATCATGG + Intergenic
1038142523 8:24862038-24862060 TAAAGATTTCTCTAAAATAATGG + Intergenic
1038924967 8:32128308-32128330 TTAAAATTTTACTGCCATCAGGG - Intronic
1040712102 8:50201032-50201054 TAAAACTTTCTCTAACATCATGG + Intronic
1040822346 8:51575962-51575984 TTAAGATTTCTATGTCTTCTTGG - Intronic
1043558240 8:81459461-81459483 TTATGTTTTCTGTGATATCAGGG + Intronic
1044524670 8:93239179-93239201 TTAAGAATTATATAACATCATGG - Intergenic
1045798311 8:106072120-106072142 TTAAGCTTTATCTGACAAAATGG - Intergenic
1045995588 8:108358452-108358474 TTAAGATTTGACTGCCATGATGG - Intronic
1046789600 8:118306949-118306971 CTAAGTTTTCTCTGAAAGCAGGG + Intronic
1047561400 8:125991148-125991170 TTATCATTTCTCTCCCATCAGGG - Intergenic
1050868652 9:10538029-10538051 TTCAGGTCTGTCTGACATCAAGG - Intronic
1051750696 9:20338062-20338084 TTCAGATTCTTCTGACCTCAGGG - Intergenic
1052284886 9:26773957-26773979 TTTATATTTTTCTGACATCTAGG - Intergenic
1053034469 9:34812509-34812531 AGATGATTTCTTTGACATCAGGG - Intergenic
1056395089 9:86174630-86174652 CTAAAAATTGTCTGACATCACGG - Intergenic
1058105117 9:100961766-100961788 TTAAGATTACTGTGTCAGCAAGG + Intergenic
1059541627 9:115136197-115136219 TAAAAATTTTTCTGAAATCAGGG - Intergenic
1059706977 9:116834493-116834515 TTAGGATTTCTATGTCTTCATGG + Intronic
1060096034 9:120791602-120791624 TAAAGATTTCTGTGACACTAAGG + Intronic
1060099526 9:120826696-120826718 CTGAGTTATCTCTGACATCAGGG - Intronic
1186029812 X:5355339-5355361 ATAAGATTTCTCTGTCTACAAGG - Intergenic
1187419915 X:19125227-19125249 TTCACATAACTCTGACATCAGGG + Intergenic
1188706233 X:33335186-33335208 TTAAGGTTCCTCTTAGATCATGG + Intronic
1190588412 X:51971284-51971306 TTAAGATTGCTTTGAAATCAGGG - Intergenic
1191025217 X:55907215-55907237 TTAAGATCTCTCTCACCTCAAGG - Intergenic
1193348821 X:80433539-80433561 GTAAGATTTCTCTGGGATTAGGG + Intronic
1193596796 X:83456242-83456264 TATAGATTTTTCTGACATAAAGG + Intergenic
1194526320 X:94982206-94982228 TTAAAATTTCAATGACTTCATGG + Intergenic
1195070955 X:101279011-101279033 TTTCCATTTCTTTGACATCAGGG + Exonic
1195910084 X:109880572-109880594 TTAAGATTCCTCTGACTGCCAGG - Intergenic
1195956884 X:110340763-110340785 TTAATACTTATCTGTCATCAAGG + Intronic
1196548658 X:116995938-116995960 TTAAGATTTGACTGCCATCCTGG - Intergenic
1197262822 X:124334831-124334853 TTGGGCTTTCTCTGACACCATGG - Intronic
1198192514 X:134323674-134323696 TTACAATTTCTCTGAAATTATGG - Intergenic
1201594873 Y:15657397-15657419 TTTAGATTTCTGTGAAATGAGGG + Intergenic