ID: 1067442924

View in Genome Browser
Species Human (GRCh38)
Location 10:46321368-46321390
Sequence TCTAGGATGTTGTCTGCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067442921_1067442924 27 Left 1067442921 10:46321318-46321340 CCATGATGTCAGAGAAATCTTAA 0: 1
1: 0
2: 2
3: 24
4: 229
Right 1067442924 10:46321368-46321390 TCTAGGATGTTGTCTGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067442924 Original CRISPR TCTAGGATGTTGTCTGCTTC TGG Intronic
No off target data available for this crispr