ID: 1067442924 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:46321368-46321390 |
| Sequence | TCTAGGATGTTGTCTGCTTC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1067442921_1067442924 | 27 | Left | 1067442921 | 10:46321318-46321340 | CCATGATGTCAGAGAAATCTTAA | 0: 1 1: 0 2: 2 3: 24 4: 229 |
||
| Right | 1067442924 | 10:46321368-46321390 | TCTAGGATGTTGTCTGCTTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1067442924 | Original CRISPR | TCTAGGATGTTGTCTGCTTC TGG | Intronic | ||
| No off target data available for this crispr | |||||