ID: 1067447147

View in Genome Browser
Species Human (GRCh38)
Location 10:46358114-46358136
Sequence TAAGTGGGCCAGTTTGAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067447138_1067447147 28 Left 1067447138 10:46358063-46358085 CCAAAACATGCGTGGGAATGCCC 0: 1
1: 8
2: 1
3: 2
4: 49
Right 1067447147 10:46358114-46358136 TAAGTGGGCCAGTTTGAACTTGG No data
1067447140_1067447147 8 Left 1067447140 10:46358083-46358105 CCCACTGTGTGGACTGTGAGACC No data
Right 1067447147 10:46358114-46358136 TAAGTGGGCCAGTTTGAACTTGG No data
1067447141_1067447147 7 Left 1067447141 10:46358084-46358106 CCACTGTGTGGACTGTGAGACCC No data
Right 1067447147 10:46358114-46358136 TAAGTGGGCCAGTTTGAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067447147 Original CRISPR TAAGTGGGCCAGTTTGAACT TGG Intergenic
No off target data available for this crispr