ID: 1067450982

View in Genome Browser
Species Human (GRCh38)
Location 10:46381670-46381692
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 2, 1: 0, 2: 0, 3: 4, 4: 80}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067450982_1067450985 2 Left 1067450982 10:46381670-46381692 CCTCAGTCGAGCTGCTTGCACCC 0: 2
1: 0
2: 0
3: 4
4: 80
Right 1067450985 10:46381695-46381717 ACCTCGTCCCTTCTGCCACCTGG 0: 2
1: 0
2: 1
3: 17
4: 155
1067450982_1067450987 3 Left 1067450982 10:46381670-46381692 CCTCAGTCGAGCTGCTTGCACCC 0: 2
1: 0
2: 0
3: 4
4: 80
Right 1067450987 10:46381696-46381718 CCTCGTCCCTTCTGCCACCTGGG No data
1067450982_1067450991 19 Left 1067450982 10:46381670-46381692 CCTCAGTCGAGCTGCTTGCACCC 0: 2
1: 0
2: 0
3: 4
4: 80
Right 1067450991 10:46381712-46381734 ACCTGGGAATTCTAAGAGCCTGG 0: 2
1: 0
2: 1
3: 26
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067450982 Original CRISPR GGGTGCAAGCAGCTCGACTG AGG (reversed) Intronic
900354784 1:2255276-2255298 AGGTCTAAGCAGCTGGACTGAGG - Intronic
904616092 1:31750726-31750748 GGGTGCAAGAAGCACTGCTGGGG - Intronic
911879070 1:103210238-103210260 GGGTGCCAGGAGCTGGAGTGTGG - Intergenic
917967464 1:180187588-180187610 GGCTGCAAACAGCCCCACTGGGG - Intronic
922785610 1:228280982-228281004 GGGTGCAAGCAGGTGGACCCGGG + Intronic
924954978 1:248917422-248917444 GGGTCCAAGCAGCTGCACAGGGG + Exonic
1067450982 10:46381670-46381692 GGGTGCAAGCAGCTCGACTGAGG - Intronic
1067586261 10:47478081-47478103 GGGTGCAAGCAGCTCGACTGAGG + Intronic
1070771523 10:79085223-79085245 GGGTGCCAGCAGCCAGGCTGTGG - Intronic
1075453365 10:122568714-122568736 GTCTGCAGGCAGCTCGGCTGTGG + Intronic
1075481759 10:122788330-122788352 GTGTGCCAGCAGCTCGGGTGTGG + Intergenic
1075561579 10:123472484-123472506 AGGTGGGAGCAGCTCTACTGGGG + Intergenic
1076921382 10:133456362-133456384 GTGTGCAGGCAGCTGGGCTGCGG + Intergenic
1077283373 11:1755340-1755362 GAGTGCCAGGAGCTCCACTGGGG + Intronic
1078020514 11:7652657-7652679 GGGTGCCAGCAGCTGTGCTGAGG + Intronic
1086559885 11:88155137-88155159 AGGTGCAAGCAGCTGTGCTGAGG - Intronic
1089672733 11:120067669-120067691 GGGAGGAAGCAGCTCCCCTGGGG + Intergenic
1090238305 11:125165210-125165232 GGGTGCAAGGAGCCGGGCTGCGG + Intronic
1090751374 11:129749091-129749113 TGGTGCATGCAGCTGGGCTGGGG - Intergenic
1092312471 12:7373490-7373512 GTGTGCAGGCAGCTGGGCTGTGG - Exonic
1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG + Exonic
1097455224 12:59792197-59792219 GGGAGAAAGCAAGTCGACTGAGG - Intergenic
1100579221 12:95922743-95922765 GGGTCCAGGCAGCTAGACTCTGG + Intronic
1102786392 12:115608432-115608454 GGCTGCAAGCAGCTTGAATGAGG - Intergenic
1104737045 12:131141659-131141681 GGGGGCAAGCAGCATGCCTGGGG + Intergenic
1105882048 13:24613983-24614005 GGCTGAAGGCAGCTCGAGTGTGG + Intergenic
1107389185 13:39945470-39945492 GGGTGCATGCATGTCGGCTGGGG - Intergenic
1107467814 13:40665854-40665876 GGGTGCAGGCAGCCCGCCTCCGG + Exonic
1117154224 14:52922061-52922083 GGGTGCAAGCAGCTTATTTGTGG + Intronic
1118783085 14:69023283-69023305 GGACGCCAGCAGCTCTACTGGGG - Intergenic
1132759879 16:1503488-1503510 TGGTGCAAACAGCTCCACTGCGG - Intronic
1140392258 16:74597484-74597506 TGGTGCAAGCAGATCACCTGAGG + Intronic
1145877649 17:28331759-28331781 GGGAGCCAGCAGCTCCACTGTGG + Intronic
1149853696 17:60059123-60059145 AGGTGCAAGCAGCCCCCCTGAGG - Intronic
1150635528 17:66910789-66910811 GGGTGCAAGCATCTAGATTCTGG - Intergenic
1151327941 17:73390414-73390436 GGGTGCCAGCACCTCCACAGTGG + Exonic
1151844872 17:76645680-76645702 GGGTGCAAGCTGAGCTACTGTGG + Intergenic
1152409548 17:80116503-80116525 ATGTGCAAGCAGCTCTACGGAGG - Intergenic
1159579423 18:70218562-70218584 GTGAGCAAGCTGCTAGACTGAGG + Intergenic
1159868868 18:73738022-73738044 GAGAGCAAGCAGCAGGACTGGGG - Intergenic
1162057645 19:8074270-8074292 GGGGACAAGCAGCTTGCCTGGGG + Intronic
1162387013 19:10365724-10365746 GGGTGCCAGCCGCTCGAGTGTGG + Exonic
1163892480 19:20029209-20029231 GGGCGCAGGCAGATCAACTGAGG - Intronic
925275194 2:2643670-2643692 GGGTTTCAGCAGCTGGACTGGGG + Intergenic
925392504 2:3506087-3506109 GGCTGGAAGCAGCTGGACTTGGG - Intronic
926632351 2:15148019-15148041 GGGTGCAAGAAGCATGTCTGGGG - Intergenic
938796906 2:134725099-134725121 GGGTGGTAGCAGCTGTACTGAGG - Intergenic
939712649 2:145541999-145542021 AGGTGCAAGCAGATCACCTGAGG - Intergenic
944291063 2:198005728-198005750 GGTTGCAGGCAACTCGCCTGAGG + Intronic
948084139 2:235232389-235232411 GGGTGCAGGCAGCCGGGCTGGGG + Intergenic
948118221 2:235509678-235509700 GGGTGCAAGCAGACGGACAGAGG - Intronic
948802408 2:240438855-240438877 GGGTGCCACCAGCTGGACGGTGG + Intronic
1168953302 20:1817297-1817319 GATTGTAAGCAGCCCGACTGGGG - Intergenic
1174552671 20:51373049-51373071 GGGTGCAAGCATATCCACTTTGG + Intergenic
1176157222 20:63627763-63627785 GGGTGCCAGCTGCGGGACTGGGG - Intergenic
1179987197 21:44928453-44928475 GACTGAAAGCAGCTCGAATGTGG + Intronic
1181030690 22:20147734-20147756 GGGTGCAGGCAGCCCCAGTGGGG - Exonic
960452420 3:117826644-117826666 GGGTGCATGCAGCTGAACTTAGG - Intergenic
967659598 3:192090685-192090707 GGGTGCATGCACATCTACTGGGG - Intergenic
970177250 4:13351767-13351789 GGGTGCAGGCAGATCACCTGAGG - Intergenic
973894205 4:55396027-55396049 AGGTGCAAGCAGCGGGAGTGAGG - Exonic
977892002 4:102322889-102322911 GGGAGCAAGCAGCAGAACTGGGG + Intronic
984875271 4:184362335-184362357 TGGAGCCAGCAGCTCGTCTGTGG - Intergenic
994874013 5:105392332-105392354 GGGTGCCAGCATCTAGACAGAGG + Intergenic
995675236 5:114655778-114655800 GGCTTCAGGCAGCTTGACTGAGG - Intergenic
999728391 5:154456008-154456030 GGTGGCAAGCAGCTTGAGTGAGG + Exonic
1001721982 5:173864468-173864490 GGGTGCAACAGGCTAGACTGTGG - Intergenic
1003899442 6:10640404-10640426 TGGTGCTAGCAGGACGACTGTGG + Intergenic
1007644173 6:43368264-43368286 AGGTTCAAGTAACTCGACTGAGG - Intronic
1008618683 6:53250515-53250537 TGGAGCAAGCAGCTTGCCTGAGG + Intergenic
1026677032 7:72436662-72436684 GAGTGAGAGCAGCTAGACTGGGG - Intronic
1034009604 7:147514878-147514900 GGGTGAAAGTAGGTCGACTAAGG - Intronic
1034429750 7:151035381-151035403 GGGTGCGAGCAGCAGGCCTGAGG - Intronic
1034501691 7:151454897-151454919 GGGTGCCCGCAGCTCCCCTGCGG - Intergenic
1038447788 8:27615751-27615773 GGGTACAGGCAGCCCCACTGTGG + Intergenic
1040298459 8:46175570-46175592 GGGTAGAAGCAGCGAGACTGGGG + Intergenic
1041253518 8:55958098-55958120 GGGTGTAAGCAGGTCTGCTGAGG - Intronic
1045038445 8:98196418-98196440 GGGTGGCAGCAGCTGGCCTGAGG - Intronic
1051704784 9:19865979-19866001 GAGTGCAAACAGCTCTATTGGGG + Intergenic
1052989658 9:34511792-34511814 GGGTTCCAGGAGCTCCACTGTGG - Intronic
1058533167 9:105927149-105927171 GGGTGCCAGGAGATAGACTGGGG - Intergenic
1060757556 9:126224198-126224220 GGGTGAAGGCAGCTTGGCTGAGG - Intergenic
1061309511 9:129753037-129753059 GGGTGTGATCAGCTCGACAGAGG + Exonic
1061924790 9:133800655-133800677 TGGTGCCAGCAGCTCTAGTGTGG + Intronic
1189989110 X:46577921-46577943 GGGTGCCCTCAGCTCAACTGAGG + Intronic
1194978180 X:100413500-100413522 AGGTCAAAGCAGCTCCACTGAGG + Intergenic