ID: 1067455835

View in Genome Browser
Species Human (GRCh38)
Location 10:46418734-46418756
Sequence CTCCCTCTCCTCCCTGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067455823_1067455835 20 Left 1067455823 10:46418691-46418713 CCCCAGCTTCTCACTCCCAGGGC No data
Right 1067455835 10:46418734-46418756 CTCCCTCTCCTCCCTGAGGCCGG No data
1067455827_1067455835 4 Left 1067455827 10:46418707-46418729 CCAGGGCCTCCCCTCCATGATCA No data
Right 1067455835 10:46418734-46418756 CTCCCTCTCCTCCCTGAGGCCGG No data
1067455826_1067455835 5 Left 1067455826 10:46418706-46418728 CCCAGGGCCTCCCCTCCATGATC No data
Right 1067455835 10:46418734-46418756 CTCCCTCTCCTCCCTGAGGCCGG No data
1067455821_1067455835 21 Left 1067455821 10:46418690-46418712 CCCCCAGCTTCTCACTCCCAGGG No data
Right 1067455835 10:46418734-46418756 CTCCCTCTCCTCCCTGAGGCCGG No data
1067455828_1067455835 -2 Left 1067455828 10:46418713-46418735 CCTCCCCTCCATGATCACCGTCT No data
Right 1067455835 10:46418734-46418756 CTCCCTCTCCTCCCTGAGGCCGG No data
1067455829_1067455835 -5 Left 1067455829 10:46418716-46418738 CCCCTCCATGATCACCGTCTCCC No data
Right 1067455835 10:46418734-46418756 CTCCCTCTCCTCCCTGAGGCCGG No data
1067455830_1067455835 -6 Left 1067455830 10:46418717-46418739 CCCTCCATGATCACCGTCTCCCT No data
Right 1067455835 10:46418734-46418756 CTCCCTCTCCTCCCTGAGGCCGG No data
1067455831_1067455835 -7 Left 1067455831 10:46418718-46418740 CCTCCATGATCACCGTCTCCCTC No data
Right 1067455835 10:46418734-46418756 CTCCCTCTCCTCCCTGAGGCCGG No data
1067455832_1067455835 -10 Left 1067455832 10:46418721-46418743 CCATGATCACCGTCTCCCTCTCC No data
Right 1067455835 10:46418734-46418756 CTCCCTCTCCTCCCTGAGGCCGG No data
1067455825_1067455835 18 Left 1067455825 10:46418693-46418715 CCAGCTTCTCACTCCCAGGGCCT No data
Right 1067455835 10:46418734-46418756 CTCCCTCTCCTCCCTGAGGCCGG No data
1067455824_1067455835 19 Left 1067455824 10:46418692-46418714 CCCAGCTTCTCACTCCCAGGGCC No data
Right 1067455835 10:46418734-46418756 CTCCCTCTCCTCCCTGAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067455835 Original CRISPR CTCCCTCTCCTCCCTGAGGC CGG Intergenic
No off target data available for this crispr