ID: 1067460298

View in Genome Browser
Species Human (GRCh38)
Location 10:46453235-46453257
Sequence AAGAATATGGGGAAGGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067460298_1067460303 -8 Left 1067460298 10:46453235-46453257 CCTGTCTCCTTCCCCATATTCTT No data
Right 1067460303 10:46453250-46453272 ATATTCTTCATCTTGTTCCCTGG No data
1067460298_1067460304 -7 Left 1067460298 10:46453235-46453257 CCTGTCTCCTTCCCCATATTCTT No data
Right 1067460304 10:46453251-46453273 TATTCTTCATCTTGTTCCCTGGG No data
1067460298_1067460307 13 Left 1067460298 10:46453235-46453257 CCTGTCTCCTTCCCCATATTCTT No data
Right 1067460307 10:46453271-46453293 GGGATCTTTCTCCCTAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067460298 Original CRISPR AAGAATATGGGGAAGGAGAC AGG (reversed) Intergenic
No off target data available for this crispr