ID: 1067460708

View in Genome Browser
Species Human (GRCh38)
Location 10:46456246-46456268
Sequence CTCTCTGTCCACCCTGATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067460708_1067460713 -2 Left 1067460708 10:46456246-46456268 CCAGTATCAGGGTGGACAGAGAG No data
Right 1067460713 10:46456267-46456289 AGTCACAGTGGTAGGACCTGGGG No data
1067460708_1067460714 -1 Left 1067460708 10:46456246-46456268 CCAGTATCAGGGTGGACAGAGAG No data
Right 1067460714 10:46456268-46456290 GTCACAGTGGTAGGACCTGGGGG No data
1067460708_1067460717 19 Left 1067460708 10:46456246-46456268 CCAGTATCAGGGTGGACAGAGAG No data
Right 1067460717 10:46456288-46456310 GGGTGTTTCTCTAAGGTATGTGG No data
1067460708_1067460712 -3 Left 1067460708 10:46456246-46456268 CCAGTATCAGGGTGGACAGAGAG No data
Right 1067460712 10:46456266-46456288 GAGTCACAGTGGTAGGACCTGGG No data
1067460708_1067460715 12 Left 1067460708 10:46456246-46456268 CCAGTATCAGGGTGGACAGAGAG No data
Right 1067460715 10:46456281-46456303 GACCTGGGGGTGTTTCTCTAAGG No data
1067460708_1067460711 -4 Left 1067460708 10:46456246-46456268 CCAGTATCAGGGTGGACAGAGAG No data
Right 1067460711 10:46456265-46456287 AGAGTCACAGTGGTAGGACCTGG No data
1067460708_1067460718 28 Left 1067460708 10:46456246-46456268 CCAGTATCAGGGTGGACAGAGAG No data
Right 1067460718 10:46456297-46456319 TCTAAGGTATGTGGAAATTTAGG No data
1067460708_1067460710 -10 Left 1067460708 10:46456246-46456268 CCAGTATCAGGGTGGACAGAGAG No data
Right 1067460710 10:46456259-46456281 GGACAGAGAGTCACAGTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067460708 Original CRISPR CTCTCTGTCCACCCTGATAC TGG (reversed) Intergenic
No off target data available for this crispr