ID: 1067467028

View in Genome Browser
Species Human (GRCh38)
Location 10:46508762-46508784
Sequence CTGTAAATGCTGATGAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067467025_1067467028 -3 Left 1067467025 10:46508742-46508764 CCTAGCACACAGTAAGTGCTCTG No data
Right 1067467028 10:46508762-46508784 CTGTAAATGCTGATGAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067467028 Original CRISPR CTGTAAATGCTGATGAGGCT GGG Intergenic
No off target data available for this crispr