ID: 1067469780

View in Genome Browser
Species Human (GRCh38)
Location 10:46528025-46528047
Sequence CCCTATCGCCCATCACCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067469780_1067469786 14 Left 1067469780 10:46528025-46528047 CCACTGGGTGATGGGCGATAGGG No data
Right 1067469786 10:46528062-46528084 TCTCTAGTTTTCTGTCCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067469780 Original CRISPR CCCTATCGCCCATCACCCAG TGG (reversed) Intergenic
No off target data available for this crispr