ID: 1067471561

View in Genome Browser
Species Human (GRCh38)
Location 10:46541854-46541876
Sequence CAGCTGTCCTACGGTATCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067471556_1067471561 -10 Left 1067471556 10:46541841-46541863 CCGACTTCCTGCCCAGCTGTCCT No data
Right 1067471561 10:46541854-46541876 CAGCTGTCCTACGGTATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067471561 Original CRISPR CAGCTGTCCTACGGTATCCC AGG Intergenic
No off target data available for this crispr