ID: 1067474378

View in Genome Browser
Species Human (GRCh38)
Location 10:46556461-46556483
Sequence CCGCGCGCTCCCGTTGGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067474378_1067474387 7 Left 1067474378 10:46556461-46556483 CCCGCCCCAACGGGAGCGCGCGG No data
Right 1067474387 10:46556491-46556513 CTCTCACCCTCTCGCCCGCCGGG No data
1067474378_1067474397 23 Left 1067474378 10:46556461-46556483 CCCGCCCCAACGGGAGCGCGCGG No data
Right 1067474397 10:46556507-46556529 CGCCGGGGCCGCGCAGGCGGGGG No data
1067474378_1067474394 21 Left 1067474378 10:46556461-46556483 CCCGCCCCAACGGGAGCGCGCGG No data
Right 1067474394 10:46556505-46556527 CCCGCCGGGGCCGCGCAGGCGGG No data
1067474378_1067474386 6 Left 1067474378 10:46556461-46556483 CCCGCCCCAACGGGAGCGCGCGG No data
Right 1067474386 10:46556490-46556512 CCTCTCACCCTCTCGCCCGCCGG No data
1067474378_1067474388 8 Left 1067474378 10:46556461-46556483 CCCGCCCCAACGGGAGCGCGCGG No data
Right 1067474388 10:46556492-46556514 TCTCACCCTCTCGCCCGCCGGGG No data
1067474378_1067474396 22 Left 1067474378 10:46556461-46556483 CCCGCCCCAACGGGAGCGCGCGG No data
Right 1067474396 10:46556506-46556528 CCGCCGGGGCCGCGCAGGCGGGG No data
1067474378_1067474391 17 Left 1067474378 10:46556461-46556483 CCCGCCCCAACGGGAGCGCGCGG No data
Right 1067474391 10:46556501-46556523 CTCGCCCGCCGGGGCCGCGCAGG No data
1067474378_1067474392 20 Left 1067474378 10:46556461-46556483 CCCGCCCCAACGGGAGCGCGCGG No data
Right 1067474392 10:46556504-46556526 GCCCGCCGGGGCCGCGCAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067474378 Original CRISPR CCGCGCGCTCCCGTTGGGGC GGG (reversed) Intergenic
No off target data available for this crispr