ID: 1067474493

View in Genome Browser
Species Human (GRCh38)
Location 10:46556812-46556834
Sequence GTGGGGACCCGGCCTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067474493_1067474500 -5 Left 1067474493 10:46556812-46556834 CCCTCCTCAGGCCGGGTCCCCAC No data
Right 1067474500 10:46556830-46556852 CCCACTGTCCTCGGTCTTTTCGG No data
1067474493_1067474508 28 Left 1067474493 10:46556812-46556834 CCCTCCTCAGGCCGGGTCCCCAC No data
Right 1067474508 10:46556863-46556885 ACCACGACCGCCTGTTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067474493 Original CRISPR GTGGGGACCCGGCCTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr