ID: 1067474500

View in Genome Browser
Species Human (GRCh38)
Location 10:46556830-46556852
Sequence CCCACTGTCCTCGGTCTTTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067474481_1067474500 14 Left 1067474481 10:46556793-46556815 CCCACCCCTCCTTCCCGACCCCT No data
Right 1067474500 10:46556830-46556852 CCCACTGTCCTCGGTCTTTTCGG No data
1067474478_1067474500 23 Left 1067474478 10:46556784-46556806 CCGCGCGCCCCCACCCCTCCTTC No data
Right 1067474500 10:46556830-46556852 CCCACTGTCCTCGGTCTTTTCGG No data
1067474479_1067474500 16 Left 1067474479 10:46556791-46556813 CCCCCACCCCTCCTTCCCGACCC No data
Right 1067474500 10:46556830-46556852 CCCACTGTCCTCGGTCTTTTCGG No data
1067474494_1067474500 -6 Left 1067474494 10:46556813-46556835 CCTCCTCAGGCCGGGTCCCCACT No data
Right 1067474500 10:46556830-46556852 CCCACTGTCCTCGGTCTTTTCGG No data
1067474482_1067474500 13 Left 1067474482 10:46556794-46556816 CCACCCCTCCTTCCCGACCCCTC No data
Right 1067474500 10:46556830-46556852 CCCACTGTCCTCGGTCTTTTCGG No data
1067474483_1067474500 10 Left 1067474483 10:46556797-46556819 CCCCTCCTTCCCGACCCCTCCTC No data
Right 1067474500 10:46556830-46556852 CCCACTGTCCTCGGTCTTTTCGG No data
1067474492_1067474500 -4 Left 1067474492 10:46556811-46556833 CCCCTCCTCAGGCCGGGTCCCCA No data
Right 1067474500 10:46556830-46556852 CCCACTGTCCTCGGTCTTTTCGG No data
1067474495_1067474500 -9 Left 1067474495 10:46556816-46556838 CCTCAGGCCGGGTCCCCACTGTC No data
Right 1067474500 10:46556830-46556852 CCCACTGTCCTCGGTCTTTTCGG No data
1067474480_1067474500 15 Left 1067474480 10:46556792-46556814 CCCCACCCCTCCTTCCCGACCCC No data
Right 1067474500 10:46556830-46556852 CCCACTGTCCTCGGTCTTTTCGG No data
1067474484_1067474500 9 Left 1067474484 10:46556798-46556820 CCCTCCTTCCCGACCCCTCCTCA No data
Right 1067474500 10:46556830-46556852 CCCACTGTCCTCGGTCTTTTCGG No data
1067474490_1067474500 1 Left 1067474490 10:46556806-46556828 CCCGACCCCTCCTCAGGCCGGGT No data
Right 1067474500 10:46556830-46556852 CCCACTGTCCTCGGTCTTTTCGG No data
1067474485_1067474500 8 Left 1067474485 10:46556799-46556821 CCTCCTTCCCGACCCCTCCTCAG No data
Right 1067474500 10:46556830-46556852 CCCACTGTCCTCGGTCTTTTCGG No data
1067474491_1067474500 0 Left 1067474491 10:46556807-46556829 CCGACCCCTCCTCAGGCCGGGTC No data
Right 1067474500 10:46556830-46556852 CCCACTGTCCTCGGTCTTTTCGG No data
1067474493_1067474500 -5 Left 1067474493 10:46556812-46556834 CCCTCCTCAGGCCGGGTCCCCAC No data
Right 1067474500 10:46556830-46556852 CCCACTGTCCTCGGTCTTTTCGG No data
1067474487_1067474500 5 Left 1067474487 10:46556802-46556824 CCTTCCCGACCCCTCCTCAGGCC No data
Right 1067474500 10:46556830-46556852 CCCACTGTCCTCGGTCTTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067474500 Original CRISPR CCCACTGTCCTCGGTCTTTT CGG Intergenic
No off target data available for this crispr