ID: 1067474508

View in Genome Browser
Species Human (GRCh38)
Location 10:46556863-46556885
Sequence ACCACGACCGCCTGTTCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067474492_1067474508 29 Left 1067474492 10:46556811-46556833 CCCCTCCTCAGGCCGGGTCCCCA No data
Right 1067474508 10:46556863-46556885 ACCACGACCGCCTGTTCTCCAGG No data
1067474493_1067474508 28 Left 1067474493 10:46556812-46556834 CCCTCCTCAGGCCGGGTCCCCAC No data
Right 1067474508 10:46556863-46556885 ACCACGACCGCCTGTTCTCCAGG No data
1067474499_1067474508 10 Left 1067474499 10:46556830-46556852 CCCACTGTCCTCGGTCTTTTCGG No data
Right 1067474508 10:46556863-46556885 ACCACGACCGCCTGTTCTCCAGG No data
1067474502_1067474508 2 Left 1067474502 10:46556838-46556860 CCTCGGTCTTTTCGGCCCCGCCC No data
Right 1067474508 10:46556863-46556885 ACCACGACCGCCTGTTCTCCAGG No data
1067474498_1067474508 11 Left 1067474498 10:46556829-46556851 CCCCACTGTCCTCGGTCTTTTCG No data
Right 1067474508 10:46556863-46556885 ACCACGACCGCCTGTTCTCCAGG No data
1067474494_1067474508 27 Left 1067474494 10:46556813-46556835 CCTCCTCAGGCCGGGTCCCCACT No data
Right 1067474508 10:46556863-46556885 ACCACGACCGCCTGTTCTCCAGG No data
1067474501_1067474508 9 Left 1067474501 10:46556831-46556853 CCACTGTCCTCGGTCTTTTCGGC No data
Right 1067474508 10:46556863-46556885 ACCACGACCGCCTGTTCTCCAGG No data
1067474495_1067474508 24 Left 1067474495 10:46556816-46556838 CCTCAGGCCGGGTCCCCACTGTC No data
Right 1067474508 10:46556863-46556885 ACCACGACCGCCTGTTCTCCAGG No data
1067474497_1067474508 17 Left 1067474497 10:46556823-46556845 CCGGGTCCCCACTGTCCTCGGTC No data
Right 1067474508 10:46556863-46556885 ACCACGACCGCCTGTTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067474508 Original CRISPR ACCACGACCGCCTGTTCTCC AGG Intergenic
No off target data available for this crispr