ID: 1067479299

View in Genome Browser
Species Human (GRCh38)
Location 10:46584879-46584901
Sequence TGTTTCCCGAGGCAGCGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067479289_1067479299 6 Left 1067479289 10:46584850-46584872 CCAGCCGCAATACCAGGCCCTGC 0: 2
1: 0
2: 0
3: 11
4: 148
Right 1067479299 10:46584879-46584901 TGTTTCCCGAGGCAGCGTCTTGG No data
1067479283_1067479299 29 Left 1067479283 10:46584827-46584849 CCTCCCCTACGGAGGGTTCTAAC 0: 2
1: 0
2: 0
3: 0
4: 21
Right 1067479299 10:46584879-46584901 TGTTTCCCGAGGCAGCGTCTTGG No data
1067479291_1067479299 -6 Left 1067479291 10:46584862-46584884 CCAGGCCCTGCCCCTCCTGTTTC 0: 2
1: 0
2: 12
3: 141
4: 1118
Right 1067479299 10:46584879-46584901 TGTTTCCCGAGGCAGCGTCTTGG No data
1067479284_1067479299 26 Left 1067479284 10:46584830-46584852 CCCCTACGGAGGGTTCTAACCCA 0: 2
1: 0
2: 0
3: 0
4: 44
Right 1067479299 10:46584879-46584901 TGTTTCCCGAGGCAGCGTCTTGG No data
1067479285_1067479299 25 Left 1067479285 10:46584831-46584853 CCCTACGGAGGGTTCTAACCCAG 0: 2
1: 0
2: 0
3: 1
4: 42
Right 1067479299 10:46584879-46584901 TGTTTCCCGAGGCAGCGTCTTGG No data
1067479288_1067479299 7 Left 1067479288 10:46584849-46584871 CCCAGCCGCAATACCAGGCCCTG No data
Right 1067479299 10:46584879-46584901 TGTTTCCCGAGGCAGCGTCTTGG No data
1067479286_1067479299 24 Left 1067479286 10:46584832-46584854 CCTACGGAGGGTTCTAACCCAGC 0: 2
1: 0
2: 0
3: 4
4: 50
Right 1067479299 10:46584879-46584901 TGTTTCCCGAGGCAGCGTCTTGG No data
1067479290_1067479299 2 Left 1067479290 10:46584854-46584876 CCGCAATACCAGGCCCTGCCCCT 0: 2
1: 0
2: 2
3: 51
4: 475
Right 1067479299 10:46584879-46584901 TGTTTCCCGAGGCAGCGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067479299 Original CRISPR TGTTTCCCGAGGCAGCGTCT TGG Intronic
No off target data available for this crispr