ID: 1067480954

View in Genome Browser
Species Human (GRCh38)
Location 10:46597419-46597441
Sequence GCTCCTGGTGGGGGGGGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067480954_1067480971 6 Left 1067480954 10:46597419-46597441 CCCAACCCCCCCCCACCAGGAGC No data
Right 1067480971 10:46597448-46597470 CACGTGTGGACAAGAGAGATGGG No data
1067480954_1067480970 5 Left 1067480954 10:46597419-46597441 CCCAACCCCCCCCCACCAGGAGC No data
Right 1067480970 10:46597447-46597469 CCACGTGTGGACAAGAGAGATGG No data
1067480954_1067480973 15 Left 1067480954 10:46597419-46597441 CCCAACCCCCCCCCACCAGGAGC No data
Right 1067480973 10:46597457-46597479 ACAAGAGAGATGGGAGGATCCGG No data
1067480954_1067480972 9 Left 1067480954 10:46597419-46597441 CCCAACCCCCCCCCACCAGGAGC No data
Right 1067480972 10:46597451-46597473 GTGTGGACAAGAGAGATGGGAGG No data
1067480954_1067480975 19 Left 1067480954 10:46597419-46597441 CCCAACCCCCCCCCACCAGGAGC No data
Right 1067480975 10:46597461-46597483 GAGAGATGGGAGGATCCGGGAGG No data
1067480954_1067480965 -8 Left 1067480954 10:46597419-46597441 CCCAACCCCCCCCCACCAGGAGC No data
Right 1067480965 10:46597434-46597456 CCAGGAGCCTTCCCCACGTGTGG No data
1067480954_1067480974 16 Left 1067480954 10:46597419-46597441 CCCAACCCCCCCCCACCAGGAGC No data
Right 1067480974 10:46597458-46597480 CAAGAGAGATGGGAGGATCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067480954 Original CRISPR GCTCCTGGTGGGGGGGGGTT GGG (reversed) Intergenic
No off target data available for this crispr