ID: 1067482271

View in Genome Browser
Species Human (GRCh38)
Location 10:46610060-46610082
Sequence CCCTTCAATGATTCGTTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067482271_1067482275 23 Left 1067482271 10:46610060-46610082 CCATTCAACGAATCATTGAAGGG No data
Right 1067482275 10:46610106-46610128 CAGTCTCTCTAGATACAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067482271 Original CRISPR CCCTTCAATGATTCGTTGAA TGG (reversed) Intergenic
No off target data available for this crispr