ID: 1067482271 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:46610060-46610082 |
Sequence | CCCTTCAATGATTCGTTGAA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1067482271_1067482275 | 23 | Left | 1067482271 | 10:46610060-46610082 | CCATTCAACGAATCATTGAAGGG | No data | ||
Right | 1067482275 | 10:46610106-46610128 | CAGTCTCTCTAGATACAAAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1067482271 | Original CRISPR | CCCTTCAATGATTCGTTGAA TGG (reversed) | Intergenic | ||