ID: 1067485576

View in Genome Browser
Species Human (GRCh38)
Location 10:46646736-46646758
Sequence CAGAATAAGGACTAGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067485576_1067485580 -2 Left 1067485576 10:46646736-46646758 CCCAGCTCCTAGTCCTTATTCTG No data
Right 1067485580 10:46646757-46646779 TGTTTGTCCTTTAAACACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067485576 Original CRISPR CAGAATAAGGACTAGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr