ID: 1067488897

View in Genome Browser
Species Human (GRCh38)
Location 10:46679238-46679260
Sequence GTGGAAAGGAGGGATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067488897_1067488903 9 Left 1067488897 10:46679238-46679260 CCTTCCTCATCCCTCCTTTCCAC No data
Right 1067488903 10:46679270-46679292 CAGACAGAAACTAAAAACCATGG 0: 4
1: 66
2: 70
3: 61
4: 495
1067488897_1067488904 16 Left 1067488897 10:46679238-46679260 CCTTCCTCATCCCTCCTTTCCAC No data
Right 1067488904 10:46679277-46679299 AAACTAAAAACCATGGCTTCAGG 0: 52
1: 57
2: 38
3: 63
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067488897 Original CRISPR GTGGAAAGGAGGGATGAGGA AGG (reversed) Intergenic
No off target data available for this crispr