ID: 1067493785

View in Genome Browser
Species Human (GRCh38)
Location 10:46742445-46742467
Sequence ATCTTAAGCTAAAAGAACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067493785_1067493787 -6 Left 1067493785 10:46742445-46742467 CCTTTGTTCTTTTAGCTTAAGAT No data
Right 1067493787 10:46742462-46742484 TAAGATTGCTTTGGCTATTCAGG 0: 50
1: 453
2: 2106
3: 4065
4: 7020

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067493785 Original CRISPR ATCTTAAGCTAAAAGAACAA AGG (reversed) Intergenic
No off target data available for this crispr