ID: 1067493787

View in Genome Browser
Species Human (GRCh38)
Location 10:46742462-46742484
Sequence TAAGATTGCTTTGGCTATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 13694
Summary {0: 50, 1: 453, 2: 2106, 3: 4065, 4: 7020}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067493783_1067493787 -1 Left 1067493783 10:46742440-46742462 CCCTGCCTTTGTTCTTTTAGCTT No data
Right 1067493787 10:46742462-46742484 TAAGATTGCTTTGGCTATTCAGG 0: 50
1: 453
2: 2106
3: 4065
4: 7020
1067493782_1067493787 0 Left 1067493782 10:46742439-46742461 CCCCTGCCTTTGTTCTTTTAGCT No data
Right 1067493787 10:46742462-46742484 TAAGATTGCTTTGGCTATTCAGG 0: 50
1: 453
2: 2106
3: 4065
4: 7020
1067493784_1067493787 -2 Left 1067493784 10:46742441-46742463 CCTGCCTTTGTTCTTTTAGCTTA No data
Right 1067493787 10:46742462-46742484 TAAGATTGCTTTGGCTATTCAGG 0: 50
1: 453
2: 2106
3: 4065
4: 7020
1067493785_1067493787 -6 Left 1067493785 10:46742445-46742467 CCTTTGTTCTTTTAGCTTAAGAT No data
Right 1067493787 10:46742462-46742484 TAAGATTGCTTTGGCTATTCAGG 0: 50
1: 453
2: 2106
3: 4065
4: 7020

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067493787 Original CRISPR TAAGATTGCTTTGGCTATTC AGG Intergenic
Too many off-targets to display for this crispr