ID: 1067495298

View in Genome Browser
Species Human (GRCh38)
Location 10:46756147-46756169
Sequence GACCCTAGGAGGGTGGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067495298_1067495307 9 Left 1067495298 10:46756147-46756169 CCAGTCCCCACCCTCCTAGGGTC No data
Right 1067495307 10:46756179-46756201 CCATCTCATCATGTGTTTTGAGG No data
1067495298_1067495308 10 Left 1067495298 10:46756147-46756169 CCAGTCCCCACCCTCCTAGGGTC No data
Right 1067495308 10:46756180-46756202 CATCTCATCATGTGTTTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067495298 Original CRISPR GACCCTAGGAGGGTGGGGAC TGG (reversed) Intergenic
No off target data available for this crispr