ID: 1067495378

View in Genome Browser
Species Human (GRCh38)
Location 10:46756595-46756617
Sequence GTGGACTAAACAGGAACCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067495375_1067495378 -10 Left 1067495375 10:46756582-46756604 CCGCACCTTTGCTGTGGACTAAA No data
Right 1067495378 10:46756595-46756617 GTGGACTAAACAGGAACCACTGG No data
1067495372_1067495378 -2 Left 1067495372 10:46756574-46756596 CCAGCCAGCCGCACCTTTGCTGT No data
Right 1067495378 10:46756595-46756617 GTGGACTAAACAGGAACCACTGG No data
1067495374_1067495378 -6 Left 1067495374 10:46756578-46756600 CCAGCCGCACCTTTGCTGTGGAC No data
Right 1067495378 10:46756595-46756617 GTGGACTAAACAGGAACCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067495378 Original CRISPR GTGGACTAAACAGGAACCAC TGG Intergenic
No off target data available for this crispr