ID: 1067496407

View in Genome Browser
Species Human (GRCh38)
Location 10:46764282-46764304
Sequence TATACTACCACAACTGGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067496400_1067496407 10 Left 1067496400 10:46764249-46764271 CCTCAGCCTTCTGAGTAGCTGGG 0: 3774
1: 101495
2: 206159
3: 237850
4: 152587
Right 1067496407 10:46764282-46764304 TATACTACCACAACTGGCTGTGG No data
1067496398_1067496407 14 Left 1067496398 10:46764245-46764267 CCTGCCTCAGCCTTCTGAGTAGC 0: 2887
1: 85071
2: 182808
3: 212496
4: 143787
Right 1067496407 10:46764282-46764304 TATACTACCACAACTGGCTGTGG No data
1067496397_1067496407 17 Left 1067496397 10:46764242-46764264 CCTCCTGCCTCAGCCTTCTGAGT 0: 392
1: 5972
2: 13874
3: 31033
4: 45483
Right 1067496407 10:46764282-46764304 TATACTACCACAACTGGCTGTGG No data
1067496402_1067496407 4 Left 1067496402 10:46764255-46764277 CCTTCTGAGTAGCTGGGACCATA 0: 26
1: 838
2: 12094
3: 73277
4: 195843
Right 1067496407 10:46764282-46764304 TATACTACCACAACTGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067496407 Original CRISPR TATACTACCACAACTGGCTG TGG Intergenic
No off target data available for this crispr