ID: 1067497776

View in Genome Browser
Species Human (GRCh38)
Location 10:46774938-46774960
Sequence GGTCGCTGGGCCCGGGCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067497760_1067497776 23 Left 1067497760 10:46774892-46774914 CCCCGACTGGCTGTCCAGCTTTC No data
Right 1067497776 10:46774938-46774960 GGTCGCTGGGCCCGGGCCGCCGG No data
1067497762_1067497776 21 Left 1067497762 10:46774894-46774916 CCGACTGGCTGTCCAGCTTTCAG No data
Right 1067497776 10:46774938-46774960 GGTCGCTGGGCCCGGGCCGCCGG No data
1067497761_1067497776 22 Left 1067497761 10:46774893-46774915 CCCGACTGGCTGTCCAGCTTTCA No data
Right 1067497776 10:46774938-46774960 GGTCGCTGGGCCCGGGCCGCCGG No data
1067497765_1067497776 9 Left 1067497765 10:46774906-46774928 CCAGCTTTCAGAGAGCTTCGGGG No data
Right 1067497776 10:46774938-46774960 GGTCGCTGGGCCCGGGCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067497776 Original CRISPR GGTCGCTGGGCCCGGGCCGC CGG Intergenic
No off target data available for this crispr