ID: 1067499494

View in Genome Browser
Species Human (GRCh38)
Location 10:46789621-46789643
Sequence GCCTCATTCGGAACTTCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067499492_1067499494 7 Left 1067499492 10:46789591-46789613 CCAAAGTTGGAAAGAGCACTTTG No data
Right 1067499494 10:46789621-46789643 GCCTCATTCGGAACTTCACCTGG No data
1067499491_1067499494 10 Left 1067499491 10:46789588-46789610 CCTCCAAAGTTGGAAAGAGCACT No data
Right 1067499494 10:46789621-46789643 GCCTCATTCGGAACTTCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067499494 Original CRISPR GCCTCATTCGGAACTTCACC TGG Intergenic