ID: 1067499494 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:46789621-46789643 |
Sequence | GCCTCATTCGGAACTTCACC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1067499492_1067499494 | 7 | Left | 1067499492 | 10:46789591-46789613 | CCAAAGTTGGAAAGAGCACTTTG | No data | ||
Right | 1067499494 | 10:46789621-46789643 | GCCTCATTCGGAACTTCACCTGG | No data | ||||
1067499491_1067499494 | 10 | Left | 1067499491 | 10:46789588-46789610 | CCTCCAAAGTTGGAAAGAGCACT | No data | ||
Right | 1067499494 | 10:46789621-46789643 | GCCTCATTCGGAACTTCACCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1067499494 | Original CRISPR | GCCTCATTCGGAACTTCACC TGG | Intergenic | ||