ID: 1067508494

View in Genome Browser
Species Human (GRCh38)
Location 10:46876320-46876342
Sequence GCTTCCCTTGGAGGACAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067508490_1067508494 -6 Left 1067508490 10:46876303-46876325 CCATGGGAAAACATACTGCTTCC No data
Right 1067508494 10:46876320-46876342 GCTTCCCTTGGAGGACAAGTGGG No data
1067508489_1067508494 -3 Left 1067508489 10:46876300-46876322 CCTCCATGGGAAAACATACTGCT No data
Right 1067508494 10:46876320-46876342 GCTTCCCTTGGAGGACAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067508494 Original CRISPR GCTTCCCTTGGAGGACAAGT GGG Intergenic
No off target data available for this crispr