ID: 1067509322

View in Genome Browser
Species Human (GRCh38)
Location 10:46882336-46882358
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 2, 1: 0, 2: 0, 3: 11, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067509315_1067509322 6 Left 1067509315 10:46882307-46882329 CCTTGAACCCTGGACATTGAGAG No data
Right 1067509322 10:46882336-46882358 TTGGAGCAACAGATTCAGCATGG 0: 2
1: 0
2: 0
3: 11
4: 155
1067509320_1067509322 -2 Left 1067509320 10:46882315-46882337 CCTGGACATTGAGAGGGTGGCTT No data
Right 1067509322 10:46882336-46882358 TTGGAGCAACAGATTCAGCATGG 0: 2
1: 0
2: 0
3: 11
4: 155
1067509319_1067509322 -1 Left 1067509319 10:46882314-46882336 CCCTGGACATTGAGAGGGTGGCT No data
Right 1067509322 10:46882336-46882358 TTGGAGCAACAGATTCAGCATGG 0: 2
1: 0
2: 0
3: 11
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067509322 Original CRISPR TTGGAGCAACAGATTCAGCA TGG Intergenic
900120399 1:1046389-1046411 TGGGAGCAACAGCCTCTGCAAGG - Exonic
907621061 1:55981144-55981166 TTGTTGCAACAGAGACAGCATGG + Intergenic
907783373 1:57587929-57587951 TTGGACCTACACTTTCAGCAAGG + Intronic
908087333 1:60650105-60650127 TTGGGGCAACAGTCTAAGCAAGG - Intergenic
912871322 1:113309663-113309685 TTGGACCATCGGATTCAGAAGGG + Intergenic
913660794 1:121004780-121004802 TGGGAGCCAGAGAGTCAGCAGGG + Intergenic
914012157 1:143787936-143787958 TGGGAGCCAGAGAGTCAGCAGGG + Intergenic
914165673 1:145173198-145173220 TGGGAGCCAGAGAGTCAGCAGGG - Intergenic
914220728 1:145679607-145679629 CTGGTGCAACAGAATGAGCATGG + Intronic
914473305 1:148002480-148002502 CTGGTGCAACAGAATGAGCATGG + Intergenic
914650788 1:149696599-149696621 TGGGAGCCAGAGAGTCAGCAGGG + Intergenic
917449138 1:175132232-175132254 TTTGGGAAACAGATTCAGTAGGG + Intronic
921702757 1:218286022-218286044 GAGGAGCAACAGACACAGCATGG - Intronic
922962257 1:229658316-229658338 GTGGAGCATCAGATACAGCCAGG + Intronic
924440782 1:244083456-244083478 GTGGAGCTCCAGATTCAGGAAGG + Intergenic
1063097495 10:2921342-2921364 TAAGAGCGATAGATTCAGCAAGG + Intergenic
1063834892 10:10001516-10001538 TTGAGGCAACAGTTTCACCATGG + Intergenic
1064020706 10:11806303-11806325 TTAAAGCAAGAGAATCAGCAAGG + Intergenic
1064882363 10:20070334-20070356 TTGAAGCAACAAAATCACCAAGG - Intronic
1065727467 10:28679508-28679530 TTGGAGCCACATTTTAAGCAAGG - Intronic
1067509322 10:46882336-46882358 TTGGAGCAACAGATTCAGCATGG + Intergenic
1067555442 10:47266588-47266610 TTGGACCAACAGCTGCATCATGG - Intergenic
1067652931 10:48169519-48169541 TTGGAGCAACAGATTCAGCATGG - Intronic
1069441539 10:68433148-68433170 AAGGAGCATCAGGTTCAGCAGGG - Intronic
1069820265 10:71223116-71223138 TTGGGGAGACAGGTTCAGCAGGG + Intronic
1072728448 10:97829038-97829060 TGGGAGAAACAGGTTCTGCATGG - Intergenic
1073599317 10:104831387-104831409 TTCCAGCCACAGGTTCAGCAGGG - Intronic
1073793857 10:106966704-106966726 GTGGAGAAACAGAGTCAGGAGGG - Intronic
1075581537 10:123622440-123622462 TTGGAGGAGCAGAATCTGCATGG + Intergenic
1075960064 10:126560725-126560747 TAGCAGCAACAGAGACAGCATGG - Intronic
1076156856 10:128211133-128211155 TTGGAGCAGCAGCTCCCGCAGGG + Intergenic
1076984011 11:222585-222607 TGGGAGCAGCAGACCCAGCAGGG - Intronic
1077324004 11:1955861-1955883 TTGGATGGACAGGTTCAGCATGG + Intronic
1077986259 11:7354384-7354406 TTGGACCATCACATTCACCATGG - Intronic
1078034829 11:7792730-7792752 ATAGAGCTACAGATTCAGGAAGG - Intergenic
1078134808 11:8643045-8643067 TTGGAGTATCAGATTCACCTGGG - Exonic
1084392406 11:68886448-68886470 TTGGAGAAACAGACTCAAAAAGG - Intergenic
1085034488 11:73291940-73291962 TTGGAGCAGCTGAGGCAGCAAGG - Intronic
1086253872 11:84850674-84850696 TAGAATAAACAGATTCAGCAAGG + Intronic
1086455081 11:86953333-86953355 TTGGAGAAACAGCTTTTGCAGGG - Intronic
1086512202 11:87571032-87571054 TTTGGGCAAAAGATTCAGTAAGG + Intergenic
1087321132 11:96660235-96660257 TTAAAGAAACAGACTCAGCAAGG - Intergenic
1087433841 11:98088042-98088064 TTGGAGAGAGAGATGCAGCATGG - Intergenic
1202806990 11_KI270721v1_random:11056-11078 TTGGATGGACAGGTTCAGCATGG + Intergenic
1093731950 12:22575090-22575112 TTGGAGAAACAAATTTAGCCTGG + Intergenic
1094473465 12:30823843-30823865 TCGGGGCTACAGTTTCAGCAGGG - Intergenic
1098850240 12:75587567-75587589 TTGTTGCAACAGATTCCTCAGGG - Intergenic
1099354062 12:81611515-81611537 ATACAGCAACACATTCAGCAGGG + Intronic
1101322923 12:103689132-103689154 CTGCAGGAACAGTTTCAGCATGG - Intronic
1102055466 12:109893400-109893422 TGTGAGCATCAGATCCAGCAGGG + Intergenic
1103294645 12:119876073-119876095 CTGGAAGAACAGATTCAGCCTGG + Exonic
1104111076 12:125704860-125704882 TTGGAGCTAAATATTAAGCAGGG - Intergenic
1107814160 13:44229211-44229233 TTGGAGCCAGAGATACAGCAGGG - Intergenic
1110132157 13:72022141-72022163 TTGGAGCACCAGGTGCAGTATGG - Intergenic
1110660477 13:78054863-78054885 TTGGGACAACAGTTTTAGCAGGG + Intergenic
1112606897 13:100915387-100915409 TGGGAGCAAGAGATGCTGCAGGG - Intergenic
1114452388 14:22836015-22836037 TTGGAGCCACAGATCCGGTATGG + Intergenic
1115172941 14:30529189-30529211 TTGGAGCACCAGGTTTAGCCTGG + Intergenic
1115446299 14:33494266-33494288 TTGAAGCAACAGTTTCATCAAGG + Intronic
1117343109 14:54808292-54808314 CTGGAGCAAGAGCTCCAGCAGGG + Intergenic
1119645244 14:76343220-76343242 TTGGAGAGACAGATTAAGCAGGG + Intronic
1121442002 14:93955388-93955410 GTGAAGCAACAGACCCAGCAAGG + Intronic
1126296246 15:47139053-47139075 TTAGAGAAAGAGAATCAGCAAGG - Intergenic
1133159759 16:3903124-3903146 TAGGAGCAATAGATCCAGGAAGG - Intergenic
1134427499 16:14165089-14165111 TTGGAACAAAAGATTCATCACGG - Intronic
1135834724 16:25814854-25814876 ATGGAGCCACAAATTCAGGAAGG + Intronic
1136088348 16:27901590-27901612 TTGCAGCATCAGATTCCACAGGG - Intronic
1139333316 16:66211164-66211186 TTGCTGAAACTGATTCAGCAGGG - Intergenic
1139820493 16:69717319-69717341 CTGCAGGAACACATTCAGCAGGG + Intronic
1142966888 17:3587216-3587238 TTGGAGGCCCAGGTTCAGCATGG + Intronic
1146503502 17:33384627-33384649 TTGGCAGAACAGATACAGCATGG - Intronic
1146889632 17:36497952-36497974 ATGGAGCATCAGAATCAGCTGGG + Intronic
1151736874 17:75948099-75948121 TTTGAGCAACAGGTTCAGAAGGG - Intronic
1154228881 18:12535562-12535584 TTGGTGCATCTGATTCAGTAGGG + Exonic
1156457090 18:37300929-37300951 CTGGAGCAAGAGATTCAGGCAGG + Intronic
1156534989 18:37853826-37853848 TTGGAGCAACTTATTAGGCAGGG - Intergenic
1157892007 18:51426775-51426797 CTGGAGCAAGAGATTCAGGGAGG - Intergenic
1158890830 18:61870508-61870530 TTGGAACCACAGAGTCGGCAGGG - Intronic
1159958701 18:74538948-74538970 TTGGAGCAAGAGATACACCCTGG - Intronic
1161144571 19:2670163-2670185 TTGGAGGAACAAAAACAGCAGGG + Intronic
1162531590 19:11239352-11239374 ATGGAGAAACAGGCTCAGCATGG + Intronic
1165735651 19:38173887-38173909 TTTGAGGAACAGCTTCCGCATGG + Intronic
1168292643 19:55364053-55364075 ATGGAGAAACAGGTTCAGTAAGG - Intergenic
926046718 2:9715399-9715421 TTGGAGAAACAGACTCAACAAGG - Intergenic
927152159 2:20202485-20202507 TTGGAGAAACCGAGTCAGAATGG + Exonic
927205650 2:20608723-20608745 TTGGGGCAGCAGAGTGAGCAAGG - Intronic
927772466 2:25875750-25875772 TTCGAGGAACAGTTTCATCAAGG - Intronic
930073222 2:47385241-47385263 TAGGAGTAAGAGATTCAACAGGG - Intronic
930428542 2:51243615-51243637 TAGAAACATCAGATTCAGCAGGG + Intergenic
930741874 2:54839966-54839988 TTGGGGGAATAAATTCAGCAAGG - Intronic
931481116 2:62641418-62641440 TTAGGGAAACAAATTCAGCAGGG + Intergenic
935388049 2:102521934-102521956 TAGGAGCAACAGACCCAGCAGGG - Intronic
936668317 2:114624870-114624892 GTGGAGCAACAGATGAACCAAGG - Intronic
943424707 2:187716388-187716410 TTTGAGCCTCAGATTCTGCATGG + Intergenic
943906421 2:193505178-193505200 TTGGGGCACCAAATTCAGAATGG - Intergenic
946590263 2:221239273-221239295 TTGGAAAAACAGTTTCATCATGG - Intergenic
1172724206 20:37025033-37025055 TTGGAGCAACTGATTCTCCAAGG - Intronic
1173693595 20:44986417-44986439 TTGTTGAAACAGATTGAGCAAGG + Intronic
1173858509 20:46266853-46266875 CTGGAGCCCCAGATTCAGTAAGG + Intronic
1175660806 20:60810374-60810396 TTGGAGAAACTTATTCTGCAGGG - Intergenic
1177945230 21:27460197-27460219 TAGGAGAAACAGTTTCAGCCAGG + Intergenic
1180854277 22:19036508-19036530 CTGGAGCACAAGGTTCAGCAAGG + Exonic
1181887683 22:26034553-26034575 TTGGAGCCACAGAGGCATCAGGG - Intergenic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1183817377 22:40314411-40314433 TTTTTGCAACTGATTCAGCATGG - Intronic
1184064602 22:42110518-42110540 TTGAAGAAACAGAGTCAGGAAGG - Intergenic
951365567 3:21777839-21777861 TTGGACCAAGAGACTCAGCAGGG - Intronic
953050777 3:39340971-39340993 CAGGAGCAACAGATACAGAAGGG + Intergenic
953458365 3:43061837-43061859 TTGGAGCAGCCCATTCAGCTGGG - Intergenic
953844962 3:46419631-46419653 TTGGAGCATCAGGTCCAGCCTGG + Intergenic
956780010 3:72596283-72596305 TTGGAGGAATAGACTGAGCAGGG + Intergenic
958786616 3:98603530-98603552 TTTGAGCAGCAGATCCTGCAAGG + Intergenic
958880831 3:99667052-99667074 ATGAAGAAACAGATTCAGGAAGG + Intronic
960430934 3:117567832-117567854 GTGAAGCAAGATATTCAGCATGG - Intergenic
963079841 3:141381040-141381062 TTGGCAAAACACATTCAGCAAGG - Intronic
963505150 3:146175728-146175750 TTGGAGCAACAGAAGTAGGAGGG - Intergenic
967466156 3:189808305-189808327 ATGGACCAGCAGATTCAGAACGG + Exonic
969030301 4:4206748-4206770 GTGGGAAAACAGATTCAGCAAGG - Intronic
973071831 4:45869738-45869760 TTGGAGAAACTTATTTAGCAGGG + Intergenic
977358289 4:95974031-95974053 TTGGAGGAACAGATTACACAGGG - Intergenic
977589927 4:98814747-98814769 TTGGAGGAACAGGTCCAGGAAGG - Intergenic
978625335 4:110678959-110678981 TTGGAGCAGGAAATACAGCATGG + Intergenic
982912369 4:161160454-161160476 TGAGAGCAACAGAGTTAGCAAGG - Intergenic
982982836 4:162163303-162163325 TTAGAGCAATACTTTCAGCAGGG - Intronic
983661011 4:170130933-170130955 TTGGAAGCACAAATTCAGCAGGG - Intergenic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
986776123 5:11015764-11015786 CTGGAGCCACTGATTCAGAATGG + Intronic
986894998 5:12354781-12354803 TGGGAGCAACAGCTGCAGTAAGG + Intergenic
988852439 5:35193034-35193056 TAGGAGCAACAGAGTCACCATGG + Intronic
990267109 5:54088859-54088881 TTGTAGCAGCAAATTCAGGATGG + Intronic
991455262 5:66796841-66796863 TTGGTGCTACAGATACAGTAAGG - Intronic
996774374 5:127118246-127118268 TGGTAGGAAAAGATTCAGCATGG + Intergenic
999505640 5:152193140-152193162 TAGGAGAAACAGAGGCAGCAGGG - Intergenic
1000449540 5:161368385-161368407 ATGGAATAACACATTCAGCAAGG + Intronic
1006379573 6:33689639-33689661 TTGGAGCAACAGGGTCAGGGTGG + Intronic
1006727299 6:36208936-36208958 TTGGAGCATCTGGGTCAGCATGG - Intronic
1010723540 6:79309644-79309666 TTGGAGCACCAGGTCCAGCCTGG + Intergenic
1013416191 6:109926784-109926806 TTGGAGCAACAGGATGAGCCTGG + Intergenic
1013659412 6:112279641-112279663 TTGGAGAAACAGCTAAAGCAAGG + Intergenic
1017352828 6:153463155-153463177 TGGGAGCAACCAGTTCAGCATGG - Intergenic
1017466521 6:154699018-154699040 TTGGAGGAAGTGTTTCAGCAAGG + Intergenic
1018144629 6:160872985-160873007 TGAGAGCAACCGGTTCAGCATGG + Intergenic
1029506756 7:100967688-100967710 TGAGAGCAAGAGATGCAGCAGGG - Exonic
1033413430 7:141141193-141141215 TTGGAGCAACAAAATAAGCAAGG - Intronic
1034685906 7:152971299-152971321 TTGGACCAGCAAATACAGCAGGG - Intergenic
1036700094 8:11007740-11007762 GTGGAGGAACAGAGGCAGCAGGG + Intronic
1038164075 8:25067825-25067847 TTGGAGCAGCAGCTTGAGCTGGG - Intergenic
1038417408 8:27407295-27407317 TTGGAGCAAGAGAATCATGAAGG - Intronic
1039188673 8:34946849-34946871 ATGGAGCAAAAGATTAGGCATGG + Intergenic
1039837404 8:41267811-41267833 TTGGAACCATAGAGTCAGCATGG - Intronic
1040127440 8:43754092-43754114 TTGGAGCCATTAATTCAGCAGGG + Intergenic
1044691559 8:94885142-94885164 TTGGAGAAAGAGATTTAGCCAGG + Exonic
1045706268 8:104926625-104926647 TGGAAGCAACAGAGTTAGCATGG + Intronic
1048190969 8:132288548-132288570 TCGGAGCTACAAATTCATCAAGG + Intronic
1050253824 9:3773409-3773431 CTGCAGCAACAAATTGAGCAAGG - Intergenic
1054888050 9:70220479-70220501 TTGGAGCAACTAGTTCAGCCTGG - Intronic
1059691074 9:116686940-116686962 ATGGAAAAACAGATTCAGTAAGG + Intronic
1060346667 9:122822794-122822816 TTGAAACACCAGATTCAGAAGGG + Intronic
1060786092 9:126452501-126452523 CCGGTGCAACACATTCAGCAGGG + Intronic
1062051870 9:134451652-134451674 TTGGAGCCTCTGATTCACCATGG - Intergenic
1187296384 X:18005297-18005319 ATGCAGCCACAGATTAAGCATGG + Intergenic
1188618188 X:32185347-32185369 GTGAAGAAACAGATTCAGGAAGG - Intronic
1189556804 X:42153505-42153527 TTGTAGCAACTGAGTCAACAGGG - Intergenic
1189907683 X:45778456-45778478 TTGGAGAAAGACATTCAGTAAGG + Intergenic
1196245665 X:113396357-113396379 GAGGAGCAACGGATCCAGCAAGG - Intergenic
1197237725 X:124087159-124087181 GTGGAACAACAGATTCAGAGAGG + Intronic
1197731207 X:129811616-129811638 TTGAAGAAACACATGCAGCATGG + Intronic
1199432696 X:147778718-147778740 TAGGAACAAAAGATTTAGCAAGG + Intergenic