ID: 1067512739

View in Genome Browser
Species Human (GRCh38)
Location 10:46909292-46909314
Sequence GAAGCATTCATCACCACGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067512739_1067512740 30 Left 1067512739 10:46909292-46909314 CCAGGCGTGGTGATGAATGCTTC No data
Right 1067512740 10:46909345-46909367 GTGTCTCCTTTTTTAAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067512739 Original CRISPR GAAGCATTCATCACCACGCC TGG (reversed) Intergenic
No off target data available for this crispr