ID: 1067516009

View in Genome Browser
Species Human (GRCh38)
Location 10:46945134-46945156
Sequence AGGAAGCTGCAGAAGATGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067516005_1067516009 12 Left 1067516005 10:46945099-46945121 CCAAGAGTTGTAGGGTGTATGTG 0: 1
1: 1
2: 0
3: 9
4: 110
Right 1067516009 10:46945134-46945156 AGGAAGCTGCAGAAGATGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067516009 Original CRISPR AGGAAGCTGCAGAAGATGAG AGG Intronic
No off target data available for this crispr