ID: 1067519068

View in Genome Browser
Species Human (GRCh38)
Location 10:46981400-46981422
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 3, 1: 2, 2: 9, 3: 102, 4: 263}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067519068_1067519071 21 Left 1067519068 10:46981400-46981422 CCTGGCTACAGCTGCTACTGAGT 0: 3
1: 2
2: 9
3: 102
4: 263
Right 1067519071 10:46981444-46981466 GACCAACACTGAGTACCTGATGG 0: 1
1: 1
2: 0
3: 8
4: 107
1067519068_1067519072 22 Left 1067519068 10:46981400-46981422 CCTGGCTACAGCTGCTACTGAGT 0: 3
1: 2
2: 9
3: 102
4: 263
Right 1067519072 10:46981445-46981467 ACCAACACTGAGTACCTGATGGG 0: 1
1: 1
2: 1
3: 11
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067519068 Original CRISPR ACTCAGTAGCAGCTGTAGCC AGG (reversed) Intronic
900093193 1:929476-929498 GCTCAGGGGCAGCTGCAGCCTGG - Intronic
904179312 1:28654728-28654750 ACTCAGTCGTGGCCGTAGCCAGG + Intergenic
904627469 1:31815102-31815124 CCTCAGCAGCACCTGCAGCCCGG + Exonic
905219100 1:36431753-36431775 ACTCAGGAGCTGCTGTACCAGGG - Intronic
905354205 1:37369711-37369733 ACTCAGCAATGGCTGTAGCCAGG - Intergenic
905465361 1:38149032-38149054 ACTCAGCAATGGCTGTAGCCAGG - Intergenic
905874031 1:41421005-41421027 AATTAGTAGCAGCTGGACCCTGG - Intergenic
906050618 1:42868339-42868361 ACTCAGCAGTGGCTGTAGCCAGG - Intergenic
906565597 1:46799026-46799048 ACCCAGGAGCAGCTGAAGGCAGG + Exonic
906930792 1:50167596-50167618 ACTCAGCAGTGGCTGTAGCCAGG + Intronic
907525941 1:55054085-55054107 AATAACTAGCAGCTGTAGGCTGG + Intronic
907780471 1:57561764-57561786 ACTCAGCAGTGGCTGTAGCCAGG - Intronic
908459970 1:64339773-64339795 TATAAGAAGCAGCTGTAGCCAGG - Intergenic
909032758 1:70561367-70561389 ACTCAGCAGTGGCTGTGGCCAGG + Intergenic
909172473 1:72314536-72314558 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
910830968 1:91462492-91462514 ACTCAGCAGTGGCCGTAGCCAGG + Intergenic
910948341 1:92617637-92617659 ACTTAGCAGTGGCTGTAGCCAGG - Intronic
911257209 1:95646433-95646455 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
911738268 1:101361002-101361024 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
912129781 1:106587128-106587150 ACTCAGCAGCAGCCGTAGCCAGG + Intergenic
912251893 1:108020456-108020478 ACTCAGCAGTGGCCGTAGCCAGG + Intergenic
912257149 1:108071824-108071846 ACTCACCATCAGCTGTAACCAGG + Intergenic
912943676 1:114067277-114067299 ACTCAGCAGTGGCCGTAGCCAGG + Intergenic
913559290 1:120001511-120001533 ACTCTGTAGTGGCAGTAGCCAGG - Intronic
915667549 1:157458744-157458766 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
915703754 1:157823757-157823779 ACTCCAAGGCAGCTGTAGCCAGG + Intergenic
915709790 1:157884571-157884593 ACTCAGCAGTGGCTATAGCCAGG - Intronic
916106065 1:161433369-161433391 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
916285459 1:163100448-163100470 ACTCAGCAGTGACTGTAGCCAGG - Intergenic
916369969 1:164081035-164081057 ACTCAGCAGTGGCTGTAGCCAGG - Intergenic
917283348 1:173399846-173399868 ACTCAGTGGTAGCTGTAGCCAGG - Intergenic
917415010 1:174799873-174799895 AGACAGCAGCAGCAGTAGCCAGG - Intronic
918918108 1:190670956-190670978 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
919124247 1:193377038-193377060 ACTCAGTGTTGGCTGTAGCCAGG + Intergenic
919241894 1:194925134-194925156 ACTCAGCAGTGGATGTAGCCAGG - Intergenic
919754944 1:201060900-201060922 AGTCAGGAGCAGCTGTGGCCAGG + Intronic
920435855 1:205946679-205946701 GCTCAGTCACAGCTGTAGCCTGG + Intergenic
921524639 1:216201621-216201643 GCTCTGTAGGAGCTGTAGACTGG - Intronic
922619506 1:226981321-226981343 ACTCAGGAGCAGCAGAAGGCCGG - Intronic
1062883470 10:997761-997783 ACTCAGATGCAGCTGCAGACGGG - Intronic
1063639508 10:7816266-7816288 ACTGAGTATCAGCTGAGGCCTGG + Intergenic
1065259546 10:23910486-23910508 AAACAGTGGCAGCTGCAGCCAGG - Intronic
1067519068 10:46981400-46981422 ACTCAGTAGCAGCTGTAGCCAGG - Intronic
1067643177 10:48070434-48070456 ACTCAGTAGCAGCTGTAGCCAGG + Intergenic
1069192178 10:65505441-65505463 GCTCAGCAGTGGCTGTAGCCAGG + Intergenic
1070638558 10:78148903-78148925 TCTCAGTACCAGCTGGAGACTGG + Intergenic
1070804410 10:79262471-79262493 ACTGAGTAACAGGTGCAGCCAGG + Intronic
1071291327 10:84191311-84191333 CCTCAGTACCAGATGGAGCCTGG + Intergenic
1071364354 10:84883594-84883616 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
1071896758 10:90076171-90076193 AATCATCAGAAGCTGTAGCCAGG - Intergenic
1071920139 10:90340522-90340544 ACTCAGCAGAGGCAGTAGCCAGG - Intergenic
1073830395 10:107377079-107377101 ACTCAGTAGTGGCTGTAACCAGG + Intergenic
1073850886 10:107616874-107616896 CCTCAGTTGCAGCAATAGCCTGG - Intergenic
1073958992 10:108904386-108904408 GCTCTGAAGCAGCTGTAGACTGG - Intergenic
1074329524 10:112491123-112491145 ACTCAGGAGAAGTTGTAGGCAGG + Intronic
1076016906 10:127034999-127035021 TCTCAGCAGCAGCTGTTGCCAGG + Intronic
1076029093 10:127142517-127142539 AGTCTGAAGCAGCTGGAGCCAGG + Intronic
1076123410 10:127954245-127954267 ACTCAGTGGTGGCTGTAGCCAGG - Intronic
1076271448 10:129155752-129155774 ACTCAGTAGTAGTCCTAGCCAGG - Intergenic
1077434509 11:2532351-2532373 ACGCAGGGGCAGCTGAAGCCGGG - Intronic
1079022665 11:16922736-16922758 CCTCAGTAGCAGCTGTGGCAGGG - Intronic
1080076726 11:28158420-28158442 ACTCAGCAGTGGCCGTAGCCAGG - Intronic
1081065342 11:38533989-38534011 ACTCAGCAGTGGCCGTAGCCAGG + Intergenic
1081378415 11:42386832-42386854 ACTCAGCAGTGGCCGTAGCCAGG - Intergenic
1082679122 11:56146852-56146874 ATTCTGGAGCAGCTGGAGCCTGG + Intergenic
1083167231 11:60898172-60898194 AGTCATCAGCCGCTGTAGCCAGG + Exonic
1086141502 11:83505298-83505320 ACTCAGCAGTGGCTGTAGCCAGG + Intronic
1087374142 11:97321449-97321471 ACTCAGCAGTGGCTGTAGCCAGG - Intergenic
1088097340 11:106116059-106116081 ACTCAGCAGTGGTTGTAGCCAGG - Intergenic
1088191524 11:107233591-107233613 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
1088449475 11:109966257-109966279 ACTCAGCAGTGGCTGTAGCCAGG - Intergenic
1089743109 11:120598655-120598677 CCTCAGTATCAGCTGTGGCAAGG + Intronic
1090209361 11:124907152-124907174 ACTCAGCAGTGGCTGTGGCCAGG + Intergenic
1090221480 11:125030697-125030719 ACTCAGCAGTGGCTGTAGCCAGG + Intronic
1091856396 12:3743969-3743991 ACTCTGTAGTATCTGTGGCCAGG + Intronic
1091980336 12:4859563-4859585 ACTCAGTGGAAGCTGGAGTCAGG - Intergenic
1092093411 12:5822539-5822561 AGTCAGCAGTGGCTGTAGCCAGG - Intronic
1092272525 12:7034596-7034618 ATTCAGCAGTGGCTGTAGCCAGG - Intronic
1093031735 12:14295030-14295052 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
1093391964 12:18634623-18634645 ACTCAGCAGTGGCTGTAGCTGGG + Intronic
1093507940 12:19891075-19891097 ACTCTGTAGCAAGTGTAGCAAGG + Intergenic
1094102660 12:26780167-26780189 ACTCAGCAGTGGCTGTAGCCAGG - Intronic
1095603980 12:44045240-44045262 ACTCAGCAGTGGCTGTAACCAGG - Intronic
1095750545 12:45705702-45705724 ACTCTGAAACAGCTCTAGCCCGG + Intergenic
1095981501 12:47977111-47977133 CCTCAGGACCAGCTGGAGCCCGG - Exonic
1096521722 12:52188281-52188303 ATACAGTAGCAGCTGTAGCAGGG + Intronic
1096735098 12:53647031-53647053 ACTCAGCAGCAGTGGTAGCCTGG - Intronic
1097437702 12:59571351-59571373 GCAGAGCAGCAGCTGTAGCCAGG + Intergenic
1097564520 12:61251543-61251565 ACTCAGTAGTGGCCGTAGCAAGG + Intergenic
1098383543 12:69895124-69895146 AGTCAGTAAAAGCTGAAGCCTGG - Intronic
1098831783 12:75373127-75373149 ACTCAGCAGTGGCTGTAGCCAGG + Intronic
1099375774 12:81894854-81894876 ACTCAGCAGTGGCTGTAGCCAGG - Intergenic
1099490548 12:83283347-83283369 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
1099508696 12:83508089-83508111 ACTCAGCAGTGGCTGTAGCCAGG - Intergenic
1099578190 12:84406303-84406325 ACTCAGTAATGGCAGTAGCCAGG - Intergenic
1099700758 12:86078645-86078667 ACTCAGCAGTGGATGTAGCCAGG + Intronic
1099735913 12:86565940-86565962 ACTCAGCGGTAGCTGTAGCCAGG - Intronic
1100241013 12:92710702-92710724 ACTCAGAAGTGGCTGTAGCCAGG + Intergenic
1100246020 12:92757714-92757736 ACCGAGTACCAGCTGGAGCCTGG + Intronic
1101534484 12:105604851-105604873 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
1102403805 12:112654718-112654740 CCTCAGTTGCAGCGGTAGGCTGG + Intronic
1102474602 12:113180549-113180571 AATCAGTAGCAGCTGGAGCAAGG - Intronic
1102904218 12:116662060-116662082 ACTCAGTGGCCTCTGTACCCCGG - Intergenic
1103035753 12:117654977-117654999 ACTCAGCAGTGGCCGTAGCCAGG - Intronic
1103396662 12:120612352-120612374 ACTCAGCAGTAGCTGTAGCCAGG - Intergenic
1104434686 12:128746476-128746498 AATCAATAGCAGCTGAAGACTGG + Intergenic
1104857354 12:131908395-131908417 TCTCTGGAGCAGCTGCAGCCCGG + Intronic
1105428746 13:20318048-20318070 ACTCAGTGGTGTCTGTAGCCAGG - Intergenic
1105843484 13:24275197-24275219 ACTCACTGACAGCTGCAGCCAGG + Intronic
1105913436 13:24891886-24891908 ACTCAGGTGCTGCTGCAGCCTGG + Intronic
1109950894 13:69501306-69501328 ACTCAGCAGTGGCCGTAGCCAGG + Intergenic
1110834013 13:80063725-80063747 ACTCAACAGTGGCTGTAGCCAGG + Intergenic
1111317627 13:86582704-86582726 ACTCAGTGGTGGCCGTAGCCAGG - Intergenic
1112589075 13:100747497-100747519 ATTAATTAGCAGCAGTAGCCTGG - Intergenic
1115829958 14:37326618-37326640 ACTCAGCAGTGGCTGTAGCCAGG + Intronic
1116059029 14:39897831-39897853 ACTCAGCAGTTTCTGTAGCCAGG - Intergenic
1116218642 14:42053430-42053452 ACTCAGCAGTGGCTGTAGCCAGG - Intergenic
1116415190 14:44670199-44670221 ACTCAGCATTGGCTGTAGCCAGG - Intergenic
1117484493 14:56180789-56180811 ACCCAGCAGCAGCAGTGGCCTGG - Intronic
1117779998 14:59222503-59222525 ACTCAGCAGTGGCTGTAGCCAGG + Intronic
1119059576 14:71461291-71461313 ACTCAGAAGTGGCCGTAGCCAGG + Intronic
1120250643 14:82058777-82058799 ATTCAGTGATAGCTGTAGCCAGG + Intergenic
1120498282 14:85262679-85262701 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
1120973828 14:90231702-90231724 ACTTAGTAGTGGCTGTAGCCAGG - Intergenic
1121110699 14:91310937-91310959 ACCCTGTATCAGCTGAAGCCAGG + Intronic
1121569630 14:94937276-94937298 ACTCGGGAGCAGCTGCCGCCTGG - Intergenic
1122451694 14:101813776-101813798 ACTCAGGAGTAGCTCCAGCCTGG + Intronic
1122461668 14:101900861-101900883 CTGCAGTGGCAGCTGTAGCCAGG - Intronic
1123817715 15:23996624-23996646 ACTCAGAGGGAGCTGTAACCTGG + Intergenic
1123978355 15:25574295-25574317 ACTTAGCAGATGCTGTAGCCAGG + Intergenic
1128642926 15:69353130-69353152 ACTCAGCAGTGGTTGTAGCCAGG - Intronic
1131596004 15:93798889-93798911 TCTCAGGAGCAGCTGTAGGAAGG + Intergenic
1132033453 15:98458319-98458341 CCCCAGTACCAGCTGGAGCCTGG + Intronic
1135147435 16:19974840-19974862 ACTCAGCAGCAGCAGTAGCCTGG + Intergenic
1139485266 16:67252646-67252668 GCTGAGTACCAGCTGGAGCCAGG + Exonic
1141054377 16:80803303-80803325 ACTCATTAGGACCTGGAGCCAGG + Intronic
1142423313 16:89986872-89986894 ATCCAGTACCAGCTTTAGCCAGG + Intergenic
1147496014 17:40916497-40916519 CCTCAGTTACAGCTGTTGCCTGG + Intergenic
1147938136 17:44025422-44025444 ACTCAGGTGCAGGTGTTGCCAGG - Intergenic
1151037673 17:70820694-70820716 ACTCAGCAGTGGCTATAGCCAGG + Intergenic
1151053904 17:71010305-71010327 ACTGAGTAGCAGTTGTGGCATGG + Intergenic
1152037425 17:77881747-77881769 GCTCAGCAGCAGCTGCGGCCAGG + Intergenic
1152095534 17:78269706-78269728 ACAGGGTAGCAGCTGCAGCCAGG - Intergenic
1154068596 18:11131984-11132006 ACTCAGCAGCGGCTGCAGCCAGG - Intronic
1154252436 18:12755783-12755805 CCTCAGCAGCGGCCGTAGCCAGG + Intergenic
1157870813 18:51228693-51228715 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
1159287902 18:66376366-66376388 ACTCAGCAGTGACTGTAGCCAGG - Intergenic
1160158446 18:76451602-76451624 ACCCCGTAGTAGCTGTGGCCGGG - Intronic
1164626804 19:29734778-29734800 ATTCAGTAGCGGCAGCAGCCAGG + Intergenic
1167465550 19:49649348-49649370 ACCCAGCAGCAGGTGCAGCCTGG + Intronic
1168539204 19:57196504-57196526 ACTCAGCAGTGGCTGTAGCCAGG + Intronic
925689521 2:6506774-6506796 ACTCAGTAGCTGGTGTGGCAGGG - Intergenic
926810268 2:16749776-16749798 ACTCAGCAGTGGCCGTAGCCAGG + Intergenic
928552317 2:32384677-32384699 AATCAGCAACAGCTGTAGCCTGG + Intronic
929269700 2:39959897-39959919 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
929636052 2:43521645-43521667 CCTGAATAGCAGCTATAGCCTGG - Intronic
930196834 2:48518727-48518749 ACACAGTACCTGCTGGAGCCAGG + Intergenic
930295082 2:49544473-49544495 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
930302826 2:49638564-49638586 ACTGAGTAGCTGCTGTCCCCTGG - Intergenic
930536497 2:52651364-52651386 GCTCAGCAGTGGCTGTAGCCAGG + Intergenic
932975797 2:76598101-76598123 ACTCAGCAGTACCTGTAGCCAGG - Intergenic
933926420 2:87094307-87094329 TCTCAGCAGCAGCCGCAGCCTGG - Intergenic
935810337 2:106791264-106791286 ACTCAGTAGATGCTATGGCCAGG + Intergenic
938030118 2:127985090-127985112 ACACAGTAGCAACTGAAGCTGGG - Intronic
938204050 2:129402059-129402081 ACTCAGCAGTGGCTGTAGCCAGG - Intergenic
939227427 2:139381814-139381836 ACTCAATAGCACCTGTAGCCAGG + Intergenic
939788553 2:146545215-146545237 ACTCAGCAGCAGCCATAGCCAGG + Intergenic
940359400 2:152781438-152781460 ACTCAGCAGTGGCTGCAGCCAGG + Intergenic
941207378 2:162590745-162590767 AGTGAGTACCATCTGTAGCCTGG + Intronic
941330534 2:164173662-164173684 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
943182219 2:184559528-184559550 ACTCAGCAGTGACTGTAGCCAGG - Intergenic
943317797 2:186411416-186411438 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
943385767 2:187202337-187202359 ACTCAGCAGTAGCCATAGCCAGG + Intergenic
943517468 2:188906354-188906376 ACTCAGCAGTGGCTGTAGCCTGG + Intergenic
943799994 2:192045679-192045701 ACTCAGTGGTGGCTGTAGCCAGG - Intronic
944990540 2:205230295-205230317 AATAATTAGCAGCAGTAGCCAGG - Intronic
945642307 2:212444739-212444761 ATTCAGCAGTGGCTGTAGCCAGG - Intronic
947440973 2:230121155-230121177 ACTCAGCAGTGGCTGTAGCCAGG - Intergenic
947576827 2:231281858-231281880 ACTCAGTGGTAGCTGTCACCTGG + Intronic
947756611 2:232570623-232570645 TCTCAGTAGCAGCTGTTCCTTGG - Intronic
948454421 2:238098164-238098186 CCTCAGCAGCAGCTGCAGCTCGG + Intronic
948970160 2:241419309-241419331 ACTCATCAGCAGGTGTAGGCAGG - Intronic
1169626721 20:7579421-7579443 ACCCAGTGGTGGCTGTAGCCAGG + Intergenic
1170892838 20:20390812-20390834 TCTCAGTAGCAGCTTTGGTCTGG - Intronic
1174159838 20:48542940-48542962 ACTGAGCAGCAGATGTGGCCAGG - Intergenic
1175112003 20:56654985-56655007 ACTTGGGAGCTGCTGTAGCCCGG - Intergenic
1177171509 21:17660952-17660974 ACACAGTGACAGTTGTAGCCTGG - Intergenic
1177731035 21:25026643-25026665 GCTCAGCAGCAGCTGTAACTAGG - Intergenic
1178012788 21:28306081-28306103 ACTCAGCAGTGGCTGTAGCCAGG - Intergenic
1179623976 21:42637883-42637905 TGTCAGCTGCAGCTGTAGCCAGG - Intergenic
1179983181 21:44907030-44907052 CCTCATGAGCAGCTGTGGCCGGG + Exonic
1181367265 22:22387629-22387651 ACTCAGCAGTGGCTGTAGCTAGG + Intergenic
1181422772 22:22813279-22813301 ACTCAGCAGTAGCTACAGCCAGG + Intronic
1182054314 22:27338001-27338023 TCTCAGTAACAGCTTGAGCCTGG - Intergenic
1182866500 22:33608777-33608799 ACTCAGTAGGTACTGCAGCCGGG - Intronic
1183590309 22:38775998-38776020 GCTAGGGAGCAGCTGTAGCCGGG - Intronic
949445739 3:4131960-4131982 ACTCAGCACTGGCTGTAGCCAGG - Intronic
951003694 3:17593388-17593410 ACTCAGCAGTGGCCGTAGCCAGG - Intronic
951291395 3:20875841-20875863 ACTCAGCAGTGGCCGTAGCCAGG + Intergenic
951970638 3:28440985-28441007 ACTCAGCAGTGGCTGTAGCCAGG + Intronic
952072221 3:29651153-29651175 AATCAGTAGCCTCTGTAGCAGGG - Intronic
952334247 3:32391593-32391615 GCTCAGTACCAGCTGTGGTCCGG + Intergenic
952587616 3:34911747-34911769 ACTCAACAGTGGCTGTAGCCAGG + Intergenic
954054289 3:48008841-48008863 ACTCAGCAGTGGCCGTAGCCAGG - Intronic
954119967 3:48491848-48491870 AATCAGTAGGAAGTGTAGCCAGG - Intronic
954912651 3:54122269-54122291 ACTCAGCGGCCGCAGTAGCCCGG + Intergenic
956306992 3:67836532-67836554 ACTCAGCAGTAGCTGTAGCCAGG - Intergenic
956703775 3:71982000-71982022 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
957754716 3:84470328-84470350 ACTCAGCAGTGGCTGTAGCCAGG - Intergenic
958487552 3:94731572-94731594 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
958934435 3:100241513-100241535 ATTCAGCAGTGGCTGTAGCCAGG - Intergenic
959377337 3:105602789-105602811 CCTCAGCAGTGGCTGTAGCCAGG + Intergenic
959745888 3:109776374-109776396 ACTTAGCAGTGGCTGTAGCCAGG + Intergenic
960155391 3:114292954-114292976 ACCCAGAAGCATCTGAAGCCTGG - Intronic
963331681 3:143922472-143922494 ACTGAGAAGTGGCTGTAGCCAGG + Intergenic
963355536 3:144205966-144205988 ACTCAGCAGTGGCCGTAGCCAGG + Intergenic
963630435 3:147724122-147724144 ACTCAGTAGTGGCTGTATCCAGG - Intergenic
963661517 3:148133039-148133061 ACTCAGTGGTGGCTGTAGCCAGG - Intergenic
963970189 3:151421052-151421074 ACTCAGTGGTGGCCGTAGCCAGG + Intronic
964679109 3:159318012-159318034 ACTCAGGAGTGGCTGTAGCCAGG + Intronic
965160200 3:165123432-165123454 CCTCAGTTGCAGCAATAGCCTGG + Intergenic
965291623 3:166888690-166888712 ACTCAGCAGTGGCCGTAGCCAGG + Intergenic
966044205 3:175530018-175530040 ACTCAGCAGTGGCTGTAGCCAGG + Intronic
966445814 3:179999461-179999483 ACTCAGCAGTGGCTGTAGCCAGG - Intronic
966896557 3:184449345-184449367 ACTCAGTGATGGCTGTAGCCAGG + Intronic
967831919 3:193926890-193926912 ACTCAGCAGTGGCCGTAGCCAGG - Intergenic
968907140 4:3459315-3459337 ACTCAGCAGTGGCTGTAGACAGG - Intergenic
969257431 4:6011752-6011774 ACTCAGCAGCAGCTGCAGTTGGG - Intergenic
971100889 4:23465519-23465541 ACTCAGCAGTAGCTGCAGCCAGG + Intergenic
971126559 4:23761209-23761231 ACTCAGCAGTGGCTGTAGCCAGG - Intronic
971460373 4:26889660-26889682 CCTCATTAGCACCTGTAGCCAGG + Intronic
971857532 4:32061953-32061975 ACTCAGCAGTAGCCATAGCCAGG + Intergenic
972201180 4:36716281-36716303 ACTCAGCAGTGGCCGTAGCCAGG + Intergenic
973103044 4:46295644-46295666 ACCCAGCAGTGGCTGTAGCCAGG - Intronic
973118556 4:46489946-46489968 ACTCAGCAATGGCTGTAGCCAGG - Intergenic
974478931 4:62419990-62420012 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
974564908 4:63569212-63569234 CCTCAGCAGTGGCTGTAGCCTGG - Intergenic
974644491 4:64673865-64673887 ATTCAGCAGTGGCTGTAGCCAGG + Intergenic
976171733 4:82311356-82311378 AATAAGCAGCAGCAGTAGCCAGG - Intergenic
976301218 4:83517230-83517252 ACTCAGCAGTGGCTGTAGCCAGG + Intronic
976824476 4:89245627-89245649 ACACAGTAGCAGCTGTCAACAGG - Exonic
977770250 4:100849534-100849556 ACACAGTGGGCGCTGTAGCCTGG + Intronic
977976466 4:103272440-103272462 ACTCAGTGGTGGCTGTAACCAGG + Intergenic
978898941 4:113925911-113925933 ACTCAGTAGTGGCTGTAGCCAGG + Intronic
979366069 4:119824979-119825001 CCTCAGTTGCAGCAGTAACCTGG + Intergenic
980385667 4:132086158-132086180 ACTCATTAGTAGCCTTAGCCAGG + Intergenic
980659730 4:135841699-135841721 ACTCAGCAGTAGCTGTAAGCAGG - Intergenic
982850943 4:160315755-160315777 ACTCAGTGGTAGCTGTAGCCAGG + Intergenic
983185199 4:164692476-164692498 ACTCAGCAGTGGCTGTAGCCAGG - Intergenic
984405549 4:179325101-179325123 ACTCAGCAGTGGCTGTAGTCAGG + Intergenic
984418141 4:179486776-179486798 ACTCAGTAGCAGCTTTAGCCAGG + Intergenic
986087229 5:4463619-4463641 ACTCAGCAGTGGCTGTAGCCAGG - Intergenic
986261506 5:6151622-6151644 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
986531274 5:8739412-8739434 ACTCAGCAGTGGCCGTAGCCAGG + Intergenic
986938213 5:12917850-12917872 ACTCAGCAGTAGCTGTAGTGAGG + Intergenic
987504516 5:18750739-18750761 ACTCAGCAGAGGCCGTAGCCAGG - Intergenic
987578216 5:19757409-19757431 ACTCAGCAGTGGCTGTAGCCAGG + Intronic
987885574 5:23807402-23807424 ACTCAGCAGTAGACGTAGCCAGG - Intergenic
988228879 5:28449027-28449049 ACTCAGCAGTGGCCGTAGCCAGG - Intergenic
989307375 5:39973721-39973743 ACTCAGCAGTGGCCGTAGCCAGG + Intergenic
989457521 5:41660866-41660888 ACTCAGCAGTAGCTATAGCCAGG + Intergenic
990444214 5:55878945-55878967 ATTCAAAAGCAGCTGTGGCCGGG - Intronic
991033680 5:62106825-62106847 ACTCATCAGTGGCTGTAGCCAGG - Intergenic
991677833 5:69106220-69106242 CCACAGTAGCAGCTGCAGCTTGG + Intronic
991946273 5:71901027-71901049 ACTCAGCAGTGGCTGTAGCCAGG - Intergenic
992597400 5:78360425-78360447 ACTCGGTCGCAGCTAAAGCCCGG + Intergenic
993203517 5:84848445-84848467 ACTCAGCAGTGGATGTAGCCAGG - Intergenic
993367345 5:87050062-87050084 ACTCAGCAGTGGCGGTAGCCAGG + Intergenic
995483524 5:112615932-112615954 TCTCAGCAGTAGATGTAGCCAGG + Intergenic
995776154 5:115726798-115726820 ACTCAGCAGCGGCTGTAGCCAGG + Intergenic
996164841 5:120211614-120211636 ACTCAGTGGTGGCCGTAGCCAGG + Intergenic
996944275 5:129047881-129047903 ACTCAGTGGTGGCTGTAGCCAGG + Intergenic
998290203 5:140907651-140907673 ACTCAGCAGTGGCTGTAGCCAGG + Intronic
999351499 5:150875734-150875756 ACTCAGCAGTGGCCGTAGCCAGG - Intronic
1001173733 5:169445542-169445564 AGTCAGTGGTGGCTGTAGCCAGG - Intergenic
1001784355 5:174399129-174399151 ATTTAGGAGCAGCTGTCGCCTGG + Intergenic
1001838978 5:174857036-174857058 ACTCAGCAGGGGCTATAGCCAGG - Intergenic
1003948381 6:11095465-11095487 ACTCTCGAGTAGCTGTAGCCGGG + Intronic
1005950145 6:30625789-30625811 GCTCTGTAGGAGCTGTAGACTGG + Exonic
1007791795 6:44313294-44313316 CGTCAGTGGCAGCTGCAGCCCGG - Exonic
1008079260 6:47177667-47177689 ACTCAGCAGTGGCCGTAGCCAGG + Intergenic
1009660568 6:66606028-66606050 ACACAGCAGTGGCTGTAGCCAGG + Intergenic
1010301828 6:74269646-74269668 ATTTAGCTGCAGCTGTAGCCTGG - Intergenic
1010323696 6:74541393-74541415 ACTCAGCAGTGGCTGTAGCCAGG - Intergenic
1012344712 6:98171224-98171246 ACTCAGTAGTGGCCTTAGCCAGG - Intergenic
1012920660 6:105218646-105218668 ACTCAGCAGTGTCTGTAGCCAGG + Intergenic
1013310291 6:108887494-108887516 CCTCAGTTCCAGCTGTAACCAGG - Intronic
1013406800 6:109850703-109850725 ACTCAGCAGTGTCTGTAGCCAGG - Intergenic
1014417124 6:121196308-121196330 ACTCAGCAGTGGCCGTAGCCAGG - Intronic
1014534062 6:122595701-122595723 ACTCAGCAGTGGCTGTAACCAGG + Intronic
1015527560 6:134187974-134187996 ACTCAGCAGTGGCTGTAGCCAGG + Intronic
1015901136 6:138068982-138069004 ACCCAGTAACAGATGTAGCAAGG - Intergenic
1016119808 6:140331791-140331813 ACTCAGTGGTGGCTGTAGCCAGG + Intergenic
1016419487 6:143869767-143869789 ACTCAGCAGTGGCTGTAGTCAGG + Intronic
1016576137 6:145571686-145571708 ACTCAGCAGTGGCCGTAGCCAGG + Intronic
1016826812 6:148396024-148396046 ACTCATCAGCAGCTGAAGCCTGG + Intronic
1017227681 6:152040185-152040207 ACTCAGTTGTGGCTGTAGCCAGG + Intronic
1017976907 6:159366245-159366267 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
1018254029 6:161900374-161900396 ACTCAGTGGCAGCAGCATCCAGG - Intronic
1018534904 6:164809603-164809625 ACTCAGCAGTGGCCGTAGCCAGG + Intergenic
1018997878 6:168724234-168724256 ACTCAGCAGAAGCTGTTACCAGG - Intergenic
1021050857 7:15982358-15982380 ACTCAGCAGGGTCTGTAGCCAGG + Intergenic
1022514182 7:30964960-30964982 ACTCAGGAGCAGGTGCAGCAAGG - Intronic
1024744337 7:52389326-52389348 ACTCAGCAATAGCCGTAGCCAGG - Intergenic
1026046364 7:66908210-66908232 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
1026175014 7:67988875-67988897 ACTCAGTAGCAGTCATGGCCGGG + Intergenic
1027436708 7:78172283-78172305 GCTCTGTAGTATCTGTAGCCTGG + Intronic
1028237954 7:88383723-88383745 ACTCAGCAGTGGCTATAGCCAGG - Intergenic
1030457331 7:109792144-109792166 ACTCAGCAGTAGCCATAGCCAGG + Intergenic
1030883155 7:114905646-114905668 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
1031474333 7:122204460-122204482 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
1031628868 7:124022022-124022044 ACTCAGCAGCAGGAGTAACCAGG - Intergenic
1031676669 7:124619187-124619209 ACTCAGCTGTGGCTGTAGCCAGG - Intergenic
1031833132 7:126650917-126650939 ACTCAGCAGTGGCTGTAGCTAGG - Intronic
1032152975 7:129446058-129446080 ACTCAGCAGTGGCCGTAGCCAGG + Intronic
1033258384 7:139821275-139821297 AGTCTGTAGCATCTGTAGGCTGG + Intronic
1037050205 8:14362779-14362801 TCTCATTAGGAGCTGTAGACCGG + Intronic
1037364458 8:18107361-18107383 ACTCAGCAATGGCTGTAGCCAGG + Intergenic
1037953785 8:23037293-23037315 ACTCAGTAGCAGCTGTAGCCAGG - Intronic
1041434913 8:57828393-57828415 ACTCACTAGCAGCCCAAGCCTGG + Intergenic
1041556200 8:59159212-59159234 ACTCAGTAGTGGCTGTAGCAAGG - Intergenic
1041935430 8:63326904-63326926 ACTCAGCAGTGGCTGTAGCCAGG - Intergenic
1044178600 8:89160976-89160998 ACACAGGAGCAGCTGAAGCTGGG - Intergenic
1044895942 8:96891417-96891439 ACTCAGCAGTGGCTGTAGCCGGG + Intronic
1046128544 8:109940695-109940717 ACTCAGCAGTAGCTGCAGTCAGG + Intergenic
1046245820 8:111561173-111561195 ACTTAGTAACAGCAGTAGACAGG - Intergenic
1047104450 8:121718092-121718114 ACTCATTAGCAGCTGTGGTCTGG + Intergenic
1047327346 8:123852412-123852434 ACTCAGTGGTCGCTGTAGCCAGG + Intronic
1047453748 8:124990212-124990234 ACTCAGAAGTGGCTGTAGCCAGG - Intergenic
1048032326 8:130644417-130644439 ATTCAGTACCAGCAGAAGCCAGG + Intergenic
1049378090 8:142298516-142298538 ACTCAGCAGCATCTGTGGCACGG - Intronic
1051475925 9:17509178-17509200 ACTCAGTAGTGGCCATAGCCAGG - Intergenic
1052227709 9:26109274-26109296 ACTCAGCAGTGGCTGTAGCCAGG - Intronic
1052442140 9:28511394-28511416 ACTCAGCAGTGGCCGTAGCCAGG + Intronic
1052561446 9:30089098-30089120 ACTCAGTAGTGCCTGTAGCTAGG + Intergenic
1052737217 9:32354676-32354698 CCTCAGGAGTGGCTGTAGCCAGG + Intergenic
1053145315 9:35707829-35707851 ACTGTGTAACAGCTGTCGCCTGG - Exonic
1055756356 9:79562739-79562761 ACACAGTAGCAGCTGTACGGGGG + Intergenic
1056156802 9:83846095-83846117 ACTCAGCAGTGGCCGTAGCCAGG - Intronic
1056314105 9:85372044-85372066 ACTCAGCAGTGGCCGTAGCCAGG + Intergenic
1056353734 9:85777431-85777453 ACTCAGCAGTGGCCGTAGCCAGG + Intergenic
1057430406 9:94988793-94988815 ACTCAGTAGCAGGTTTGGGCTGG - Intronic
1058124703 9:101178279-101178301 ACTCAGCAGTGGCAGTAGCCAGG - Intronic
1058131676 9:101260608-101260630 ACTCAAGAGAAGCTGCAGCCTGG + Intronic
1058259137 9:102808785-102808807 ACTCAGCAGTGGCTGTTGCCAGG + Intergenic
1059107952 9:111527574-111527596 ACTCAGAAGTAGCTGGACCCAGG + Exonic
1059196375 9:112374966-112374988 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
1060205622 9:121681147-121681169 ACTTAGTAGCAGTTGGAGCTTGG - Intronic
1060533104 9:124360395-124360417 CCTCTGTAGCAGCTGTCCCCGGG - Intronic
1185488255 X:499288-499310 ACTCAGATGCAGCTGCATCCCGG - Intergenic
1186279635 X:7978018-7978040 ACTCAGCAGTGGCCGTAGCCAGG - Intergenic
1188651324 X:32634499-32634521 AATAATCAGCAGCTGTAGCCAGG - Intronic
1190527776 X:51345420-51345442 ACTCAGCAGCAGCTGTAGCCAGG + Intergenic
1190797271 X:53757472-53757494 ACACAGCAGCAGCTGGAACCTGG - Intergenic
1190913069 X:54789610-54789632 ACACAGCAGCAGCTGGAACCTGG - Intronic
1190996627 X:55616587-55616609 ACTCAGCAGTGGCAGTAGCCAGG + Intergenic
1191629901 X:63311684-63311706 ACTCAGTGGTGGCTGTAGCCAGG + Intergenic
1191719118 X:64214812-64214834 ACTCAGTGGTGGCTGCAGCCAGG + Intergenic
1191941139 X:66482978-66483000 ACTCAGCAGTGGTTGTAGCCAGG + Intergenic
1191946474 X:66539920-66539942 ACTCAGCAGTGGCTATAGCCAGG - Intergenic
1192297586 X:69867128-69867150 ACTCAGCAGTGGCTGTAGCCAGG + Intronic
1193297899 X:79853556-79853578 ACTGAGCAGTAGCTGTAGCCAGG - Intergenic
1193356374 X:80524041-80524063 ACTCAGCAGTGGCAGTAGCCAGG - Intergenic
1193447284 X:81619662-81619684 ACTCAGCAGTGGCTCTAGCCAGG - Intergenic
1194443662 X:93962002-93962024 ACTCAGCAGTGGCCGTAGCCAGG - Intergenic
1194747959 X:97650179-97650201 ACTCACTAGCAGATTTAACCTGG - Intergenic
1195748395 X:108141171-108141193 ACTCAGCAGGGGCTGTAGCCAGG + Intronic
1195748804 X:108144462-108144484 ACTCAGCAGGGGCTGTAGCCAGG + Intronic
1195782225 X:108478975-108478997 ACTCAGCAGAGGCTGTAGCCAGG + Intronic
1196114379 X:111983238-111983260 ACTCAGCAGTGACTGTAGCCAGG + Intronic
1197182223 X:123548681-123548703 ACTCAGCAGTGGCTGTAGCCAGG - Intergenic
1197244922 X:124158102-124158124 ACTCAGCAGTGGCTGTAGCCAGG + Intronic
1197500942 X:127242053-127242075 ACTGAGTAGTAGCAGTAGCCAGG - Intergenic
1198170126 X:134097140-134097162 ACTCAGTGGTGGCTATAGCCAGG - Intergenic
1198335855 X:135665616-135665638 TCACACTAGGAGCTGTAGCCTGG + Intergenic
1199310301 X:146313502-146313524 ACTCAGCAGTGGCTATAGCCAGG + Intergenic
1200397491 X:155999668-155999690 CCCCAGAAGCAGCTGGAGCCTGG - Intronic
1201529539 Y:14977006-14977028 ACACATCAGCAGCTATAGCCAGG + Intergenic
1202058249 Y:20858133-20858155 TCACAGTAGGAGCTGTAGACTGG + Intergenic