ID: 1067523609

View in Genome Browser
Species Human (GRCh38)
Location 10:47025828-47025850
Sequence TCACAGGCCTCCACCCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067523609_1067523612 7 Left 1067523609 10:47025828-47025850 CCAGGCTGGGTGGAGGCCTGTGA No data
Right 1067523612 10:47025858-47025880 TCACCCTTAGCTTCCTGAAGAGG No data
1067523609_1067523617 14 Left 1067523609 10:47025828-47025850 CCAGGCTGGGTGGAGGCCTGTGA No data
Right 1067523617 10:47025865-47025887 TAGCTTCCTGAAGAGGGGCACGG No data
1067523609_1067523614 9 Left 1067523609 10:47025828-47025850 CCAGGCTGGGTGGAGGCCTGTGA No data
Right 1067523614 10:47025860-47025882 ACCCTTAGCTTCCTGAAGAGGGG No data
1067523609_1067523613 8 Left 1067523609 10:47025828-47025850 CCAGGCTGGGTGGAGGCCTGTGA No data
Right 1067523613 10:47025859-47025881 CACCCTTAGCTTCCTGAAGAGGG No data
1067523609_1067523618 17 Left 1067523609 10:47025828-47025850 CCAGGCTGGGTGGAGGCCTGTGA No data
Right 1067523618 10:47025868-47025890 CTTCCTGAAGAGGGGCACGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067523609 Original CRISPR TCACAGGCCTCCACCCAGCC TGG (reversed) Intergenic
No off target data available for this crispr