ID: 1067523610

View in Genome Browser
Species Human (GRCh38)
Location 10:47025844-47025866
Sequence TAAGGGTGACTGGAGCTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067523610_1067523612 -9 Left 1067523610 10:47025844-47025866 CCTGTGAGCTCCAGTCACCCTTA No data
Right 1067523612 10:47025858-47025880 TCACCCTTAGCTTCCTGAAGAGG No data
1067523610_1067523618 1 Left 1067523610 10:47025844-47025866 CCTGTGAGCTCCAGTCACCCTTA No data
Right 1067523618 10:47025868-47025890 CTTCCTGAAGAGGGGCACGGAGG No data
1067523610_1067523621 28 Left 1067523610 10:47025844-47025866 CCTGTGAGCTCCAGTCACCCTTA No data
Right 1067523621 10:47025895-47025917 TCTGCCACTCTGGCCCCTCCTGG No data
1067523610_1067523614 -7 Left 1067523610 10:47025844-47025866 CCTGTGAGCTCCAGTCACCCTTA No data
Right 1067523614 10:47025860-47025882 ACCCTTAGCTTCCTGAAGAGGGG No data
1067523610_1067523613 -8 Left 1067523610 10:47025844-47025866 CCTGTGAGCTCCAGTCACCCTTA No data
Right 1067523613 10:47025859-47025881 CACCCTTAGCTTCCTGAAGAGGG No data
1067523610_1067523620 18 Left 1067523610 10:47025844-47025866 CCTGTGAGCTCCAGTCACCCTTA No data
Right 1067523620 10:47025885-47025907 CGGAGGTCTGTCTGCCACTCTGG No data
1067523610_1067523617 -2 Left 1067523610 10:47025844-47025866 CCTGTGAGCTCCAGTCACCCTTA No data
Right 1067523617 10:47025865-47025887 TAGCTTCCTGAAGAGGGGCACGG No data
1067523610_1067523622 29 Left 1067523610 10:47025844-47025866 CCTGTGAGCTCCAGTCACCCTTA No data
Right 1067523622 10:47025896-47025918 CTGCCACTCTGGCCCCTCCTGGG No data
1067523610_1067523623 30 Left 1067523610 10:47025844-47025866 CCTGTGAGCTCCAGTCACCCTTA No data
Right 1067523623 10:47025897-47025919 TGCCACTCTGGCCCCTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067523610 Original CRISPR TAAGGGTGACTGGAGCTCAC AGG (reversed) Intergenic
No off target data available for this crispr