ID: 1067523617

View in Genome Browser
Species Human (GRCh38)
Location 10:47025865-47025887
Sequence TAGCTTCCTGAAGAGGGGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067523604_1067523617 30 Left 1067523604 10:47025812-47025834 CCTGGGAGAGAGGAGTCCAGGCT No data
Right 1067523617 10:47025865-47025887 TAGCTTCCTGAAGAGGGGCACGG No data
1067523609_1067523617 14 Left 1067523609 10:47025828-47025850 CCAGGCTGGGTGGAGGCCTGTGA No data
Right 1067523617 10:47025865-47025887 TAGCTTCCTGAAGAGGGGCACGG No data
1067523610_1067523617 -2 Left 1067523610 10:47025844-47025866 CCTGTGAGCTCCAGTCACCCTTA No data
Right 1067523617 10:47025865-47025887 TAGCTTCCTGAAGAGGGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067523617 Original CRISPR TAGCTTCCTGAAGAGGGGCA CGG Intergenic
No off target data available for this crispr