ID: 1067524720

View in Genome Browser
Species Human (GRCh38)
Location 10:47031374-47031396
Sequence TTTGAGTTCTTGAAATGTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067524716_1067524720 -4 Left 1067524716 10:47031355-47031377 CCCTTGCTGTGTCAAGACATTTG No data
Right 1067524720 10:47031374-47031396 TTTGAGTTCTTGAAATGTAGGGG No data
1067524715_1067524720 13 Left 1067524715 10:47031338-47031360 CCAGGTCACGTGGTTCTCCCTTG No data
Right 1067524720 10:47031374-47031396 TTTGAGTTCTTGAAATGTAGGGG No data
1067524714_1067524720 19 Left 1067524714 10:47031332-47031354 CCTGAGCCAGGTCACGTGGTTCT No data
Right 1067524720 10:47031374-47031396 TTTGAGTTCTTGAAATGTAGGGG No data
1067524717_1067524720 -5 Left 1067524717 10:47031356-47031378 CCTTGCTGTGTCAAGACATTTGA No data
Right 1067524720 10:47031374-47031396 TTTGAGTTCTTGAAATGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067524720 Original CRISPR TTTGAGTTCTTGAAATGTAG GGG Intergenic
No off target data available for this crispr