ID: 1067525071

View in Genome Browser
Species Human (GRCh38)
Location 10:47033640-47033662
Sequence GGATGCACTGGACCAGCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067525071_1067525081 10 Left 1067525071 10:47033640-47033662 CCTTGGGCTGGTCCAGTGCATCC No data
Right 1067525081 10:47033673-47033695 GTGGGGTGCAGGCGCCATGCGGG No data
1067525071_1067525075 -7 Left 1067525071 10:47033640-47033662 CCTTGGGCTGGTCCAGTGCATCC No data
Right 1067525075 10:47033656-47033678 TGCATCCCTGATGCCTCGTGGGG No data
1067525071_1067525074 -8 Left 1067525071 10:47033640-47033662 CCTTGGGCTGGTCCAGTGCATCC No data
Right 1067525074 10:47033655-47033677 GTGCATCCCTGATGCCTCGTGGG No data
1067525071_1067525078 -1 Left 1067525071 10:47033640-47033662 CCTTGGGCTGGTCCAGTGCATCC No data
Right 1067525078 10:47033662-47033684 CCTGATGCCTCGTGGGGTGCAGG No data
1067525071_1067525082 11 Left 1067525071 10:47033640-47033662 CCTTGGGCTGGTCCAGTGCATCC No data
Right 1067525082 10:47033674-47033696 TGGGGTGCAGGCGCCATGCGGGG No data
1067525071_1067525073 -9 Left 1067525071 10:47033640-47033662 CCTTGGGCTGGTCCAGTGCATCC No data
Right 1067525073 10:47033654-47033676 AGTGCATCCCTGATGCCTCGTGG No data
1067525071_1067525084 25 Left 1067525071 10:47033640-47033662 CCTTGGGCTGGTCCAGTGCATCC No data
Right 1067525084 10:47033688-47033710 CATGCGGGGTGCAGTCCTGCAGG No data
1067525071_1067525080 9 Left 1067525071 10:47033640-47033662 CCTTGGGCTGGTCCAGTGCATCC No data
Right 1067525080 10:47033672-47033694 CGTGGGGTGCAGGCGCCATGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067525071 Original CRISPR GGATGCACTGGACCAGCCCA AGG (reversed) Intergenic
No off target data available for this crispr