ID: 1067525074

View in Genome Browser
Species Human (GRCh38)
Location 10:47033655-47033677
Sequence GTGCATCCCTGATGCCTCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067525071_1067525074 -8 Left 1067525071 10:47033640-47033662 CCTTGGGCTGGTCCAGTGCATCC No data
Right 1067525074 10:47033655-47033677 GTGCATCCCTGATGCCTCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067525074 Original CRISPR GTGCATCCCTGATGCCTCGT GGG Intergenic
No off target data available for this crispr