ID: 1067526586

View in Genome Browser
Species Human (GRCh38)
Location 10:47042992-47043014
Sequence ACAGCAGTCTCCCTCTGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067526586_1067526593 18 Left 1067526586 10:47042992-47043014 CCTCAGCAGAGGGAGACTGCTGT No data
Right 1067526593 10:47043033-47043055 CCACCCAGGGTGCCACACGCAGG No data
1067526586_1067526591 5 Left 1067526586 10:47042992-47043014 CCTCAGCAGAGGGAGACTGCTGT No data
Right 1067526591 10:47043020-47043042 CCAGAGCGTTCTTCCACCCAGGG No data
1067526586_1067526589 4 Left 1067526586 10:47042992-47043014 CCTCAGCAGAGGGAGACTGCTGT No data
Right 1067526589 10:47043019-47043041 ACCAGAGCGTTCTTCCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067526586 Original CRISPR ACAGCAGTCTCCCTCTGCTG AGG (reversed) Intergenic
No off target data available for this crispr