ID: 1067526590

View in Genome Browser
Species Human (GRCh38)
Location 10:47043020-47043042
Sequence CCCTGGGTGGAAGAACGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067526590_1067526600 24 Left 1067526590 10:47043020-47043042 CCAGAGCGTTCTTCCACCCAGGG No data
Right 1067526600 10:47043067-47043089 TCTGCCCAATGTGATCTGGATGG No data
1067526590_1067526593 -10 Left 1067526590 10:47043020-47043042 CCAGAGCGTTCTTCCACCCAGGG No data
Right 1067526593 10:47043033-47043055 CCACCCAGGGTGCCACACGCAGG No data
1067526590_1067526598 20 Left 1067526590 10:47043020-47043042 CCAGAGCGTTCTTCCACCCAGGG No data
Right 1067526598 10:47043063-47043085 AACCTCTGCCCAATGTGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067526590 Original CRISPR CCCTGGGTGGAAGAACGCTC TGG (reversed) Intergenic
No off target data available for this crispr