ID: 1067528141

View in Genome Browser
Species Human (GRCh38)
Location 10:47050725-47050747
Sequence TGAGGAGGAGGAGAGGGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067528141_1067528147 -10 Left 1067528141 10:47050725-47050747 CCACTCCCCTCTCCTCCTCCTCA No data
Right 1067528147 10:47050738-47050760 CTCCTCCTCAGGCCTGCTGCTGG No data
1067528141_1067528152 14 Left 1067528141 10:47050725-47050747 CCACTCCCCTCTCCTCCTCCTCA No data
Right 1067528152 10:47050762-47050784 TCCAAGGAAGCTGCTGAGATAGG No data
1067528141_1067528154 15 Left 1067528141 10:47050725-47050747 CCACTCCCCTCTCCTCCTCCTCA No data
Right 1067528154 10:47050763-47050785 CCAAGGAAGCTGCTGAGATAGGG No data
1067528141_1067528150 -2 Left 1067528141 10:47050725-47050747 CCACTCCCCTCTCCTCCTCCTCA No data
Right 1067528150 10:47050746-47050768 CAGGCCTGCTGCTGGCTCCAAGG No data
1067528141_1067528155 20 Left 1067528141 10:47050725-47050747 CCACTCCCCTCTCCTCCTCCTCA No data
Right 1067528155 10:47050768-47050790 GAAGCTGCTGAGATAGGGATAGG No data
1067528141_1067528156 21 Left 1067528141 10:47050725-47050747 CCACTCCCCTCTCCTCCTCCTCA No data
Right 1067528156 10:47050769-47050791 AAGCTGCTGAGATAGGGATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067528141 Original CRISPR TGAGGAGGAGGAGAGGGGAG TGG (reversed) Intergenic
No off target data available for this crispr