ID: 1067528144

View in Genome Browser
Species Human (GRCh38)
Location 10:47050731-47050753
Sequence CAGGCCTGAGGAGGAGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067528144_1067528150 -8 Left 1067528144 10:47050731-47050753 CCCTCTCCTCCTCCTCAGGCCTG No data
Right 1067528150 10:47050746-47050768 CAGGCCTGCTGCTGGCTCCAAGG No data
1067528144_1067528154 9 Left 1067528144 10:47050731-47050753 CCCTCTCCTCCTCCTCAGGCCTG No data
Right 1067528154 10:47050763-47050785 CCAAGGAAGCTGCTGAGATAGGG No data
1067528144_1067528155 14 Left 1067528144 10:47050731-47050753 CCCTCTCCTCCTCCTCAGGCCTG No data
Right 1067528155 10:47050768-47050790 GAAGCTGCTGAGATAGGGATAGG No data
1067528144_1067528152 8 Left 1067528144 10:47050731-47050753 CCCTCTCCTCCTCCTCAGGCCTG No data
Right 1067528152 10:47050762-47050784 TCCAAGGAAGCTGCTGAGATAGG No data
1067528144_1067528156 15 Left 1067528144 10:47050731-47050753 CCCTCTCCTCCTCCTCAGGCCTG No data
Right 1067528156 10:47050769-47050791 AAGCTGCTGAGATAGGGATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067528144 Original CRISPR CAGGCCTGAGGAGGAGGAGA GGG (reversed) Intergenic