ID: 1067528146

View in Genome Browser
Species Human (GRCh38)
Location 10:47050737-47050759
Sequence CAGCAGCAGGCCTGAGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067528146_1067528154 3 Left 1067528146 10:47050737-47050759 CCTCCTCCTCAGGCCTGCTGCTG No data
Right 1067528154 10:47050763-47050785 CCAAGGAAGCTGCTGAGATAGGG No data
1067528146_1067528152 2 Left 1067528146 10:47050737-47050759 CCTCCTCCTCAGGCCTGCTGCTG No data
Right 1067528152 10:47050762-47050784 TCCAAGGAAGCTGCTGAGATAGG No data
1067528146_1067528155 8 Left 1067528146 10:47050737-47050759 CCTCCTCCTCAGGCCTGCTGCTG No data
Right 1067528155 10:47050768-47050790 GAAGCTGCTGAGATAGGGATAGG No data
1067528146_1067528156 9 Left 1067528146 10:47050737-47050759 CCTCCTCCTCAGGCCTGCTGCTG No data
Right 1067528156 10:47050769-47050791 AAGCTGCTGAGATAGGGATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067528146 Original CRISPR CAGCAGCAGGCCTGAGGAGG AGG (reversed) Intergenic
No off target data available for this crispr