ID: 1067528149

View in Genome Browser
Species Human (GRCh38)
Location 10:47050743-47050765
Sequence TGGAGCCAGCAGCAGGCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067528149_1067528155 2 Left 1067528149 10:47050743-47050765 CCTCAGGCCTGCTGCTGGCTCCA No data
Right 1067528155 10:47050768-47050790 GAAGCTGCTGAGATAGGGATAGG No data
1067528149_1067528156 3 Left 1067528149 10:47050743-47050765 CCTCAGGCCTGCTGCTGGCTCCA No data
Right 1067528156 10:47050769-47050791 AAGCTGCTGAGATAGGGATAGGG No data
1067528149_1067528157 28 Left 1067528149 10:47050743-47050765 CCTCAGGCCTGCTGCTGGCTCCA No data
Right 1067528157 10:47050794-47050816 AGAGTTCCATGCTAACAAAATGG No data
1067528149_1067528154 -3 Left 1067528149 10:47050743-47050765 CCTCAGGCCTGCTGCTGGCTCCA No data
Right 1067528154 10:47050763-47050785 CCAAGGAAGCTGCTGAGATAGGG No data
1067528149_1067528152 -4 Left 1067528149 10:47050743-47050765 CCTCAGGCCTGCTGCTGGCTCCA No data
Right 1067528152 10:47050762-47050784 TCCAAGGAAGCTGCTGAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067528149 Original CRISPR TGGAGCCAGCAGCAGGCCTG AGG (reversed) Intergenic
No off target data available for this crispr