ID: 1067528150

View in Genome Browser
Species Human (GRCh38)
Location 10:47050746-47050768
Sequence CAGGCCTGCTGCTGGCTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067528144_1067528150 -8 Left 1067528144 10:47050731-47050753 CCCTCTCCTCCTCCTCAGGCCTG No data
Right 1067528150 10:47050746-47050768 CAGGCCTGCTGCTGGCTCCAAGG No data
1067528143_1067528150 -7 Left 1067528143 10:47050730-47050752 CCCCTCTCCTCCTCCTCAGGCCT No data
Right 1067528150 10:47050746-47050768 CAGGCCTGCTGCTGGCTCCAAGG No data
1067528145_1067528150 -9 Left 1067528145 10:47050732-47050754 CCTCTCCTCCTCCTCAGGCCTGC No data
Right 1067528150 10:47050746-47050768 CAGGCCTGCTGCTGGCTCCAAGG No data
1067528141_1067528150 -2 Left 1067528141 10:47050725-47050747 CCACTCCCCTCTCCTCCTCCTCA No data
Right 1067528150 10:47050746-47050768 CAGGCCTGCTGCTGGCTCCAAGG No data
1067528138_1067528150 28 Left 1067528138 10:47050695-47050717 CCTGTGGATTCTCTCTTGACAGC No data
Right 1067528150 10:47050746-47050768 CAGGCCTGCTGCTGGCTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067528150 Original CRISPR CAGGCCTGCTGCTGGCTCCA AGG Intergenic
No off target data available for this crispr