ID: 1067528154

View in Genome Browser
Species Human (GRCh38)
Location 10:47050763-47050785
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067528148_1067528154 0 Left 1067528148 10:47050740-47050762 CCTCCTCAGGCCTGCTGCTGGCT No data
Right 1067528154 10:47050763-47050785 CCAAGGAAGCTGCTGAGATAGGG No data
1067528149_1067528154 -3 Left 1067528149 10:47050743-47050765 CCTCAGGCCTGCTGCTGGCTCCA No data
Right 1067528154 10:47050763-47050785 CCAAGGAAGCTGCTGAGATAGGG No data
1067528151_1067528154 -10 Left 1067528151 10:47050750-47050772 CCTGCTGCTGGCTCCAAGGAAGC No data
Right 1067528154 10:47050763-47050785 CCAAGGAAGCTGCTGAGATAGGG No data
1067528145_1067528154 8 Left 1067528145 10:47050732-47050754 CCTCTCCTCCTCCTCAGGCCTGC No data
Right 1067528154 10:47050763-47050785 CCAAGGAAGCTGCTGAGATAGGG No data
1067528141_1067528154 15 Left 1067528141 10:47050725-47050747 CCACTCCCCTCTCCTCCTCCTCA No data
Right 1067528154 10:47050763-47050785 CCAAGGAAGCTGCTGAGATAGGG No data
1067528144_1067528154 9 Left 1067528144 10:47050731-47050753 CCCTCTCCTCCTCCTCAGGCCTG No data
Right 1067528154 10:47050763-47050785 CCAAGGAAGCTGCTGAGATAGGG No data
1067528146_1067528154 3 Left 1067528146 10:47050737-47050759 CCTCCTCCTCAGGCCTGCTGCTG No data
Right 1067528154 10:47050763-47050785 CCAAGGAAGCTGCTGAGATAGGG No data
1067528143_1067528154 10 Left 1067528143 10:47050730-47050752 CCCCTCTCCTCCTCCTCAGGCCT No data
Right 1067528154 10:47050763-47050785 CCAAGGAAGCTGCTGAGATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067528154 Original CRISPR CCAAGGAAGCTGCTGAGATA GGG Intergenic
No off target data available for this crispr